\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918056146:

Variant ID: vg0918056146 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18056146
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTACGTGGCATTGACGTAGCGCTTAGGTGGCATTAAAATAAAAAAATATATGCGGGTCCATTTATCATTCACAAAAAAAAAAAAGTGTGCGACCCACT[A/G]
ACATGTAGCTCCCATATGTCATCCTCTCTTATCCCTTCTTCCTCCTCACTCTCCTCCCTTCTCTATCTCTCCCTTTTTCTCTTCCTACGTGGGGAGCGGC

Reverse complement sequence

GCCGCTCCCCACGTAGGAAGAGAAAAAGGGAGAGATAGAGAAGGGAGGAGAGTGAGGAGGAAGAAGGGATAAGAGAGGATGACATATGGGAGCTACATGT[T/C]
AGTGGGTCGCACACTTTTTTTTTTTTGTGAATGATAAATGGACCCGCATATATTTTTTTATTTTAATGCCACCTAAGCGCTACGTCAATGCCACGTAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 11.00% 1.21% 0.95% NA
All Indica  2759 92.40% 4.00% 1.99% 1.63% NA
All Japonica  1512 93.30% 6.70% 0.00% 0.00% NA
Aus  269 19.00% 80.70% 0.37% 0.00% NA
Indica I  595 92.10% 3.70% 4.03% 0.17% NA
Indica II  465 94.80% 1.30% 1.51% 2.37% NA
Indica III  913 95.40% 2.20% 0.44% 1.97% NA
Indica Intermediate  786 87.80% 7.80% 2.54% 1.91% NA
Temperate Japonica  767 87.60% 12.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918056146 A -> G LOC_Os09g29680.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:79.171; most accessible tissue: Minghui63 root, score: 93.566 N N N N
vg0918056146 A -> G LOC_Os09g29690.1 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:79.171; most accessible tissue: Minghui63 root, score: 93.566 N N N N
vg0918056146 A -> G LOC_Os09g29700.1 upstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:79.171; most accessible tissue: Minghui63 root, score: 93.566 N N N N
vg0918056146 A -> G LOC_Os09g29680-LOC_Os09g29690 intergenic_region ; MODIFIER silent_mutation Average:79.171; most accessible tissue: Minghui63 root, score: 93.566 N N N N
vg0918056146 A -> DEL N N silent_mutation Average:79.171; most accessible tissue: Minghui63 root, score: 93.566 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918056146 A G 0.04 0.04 0.05 0.04 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918056146 NA 2.58E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 2.19E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.14E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.20E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 5.67E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 8.90E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 7.10E-06 mr1931 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 6.55E-06 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 6.91E-07 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 2.08E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.40E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 5.09E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.97E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 9.76E-08 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 2.13E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 4.12E-06 7.06E-09 mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 9.70E-08 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.80E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918056146 NA 1.11E-11 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251