\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917631772:

Variant ID: vg0917631772 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17631772
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.05, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAGCCGATCTGGACTTCAGCCGATTCTTGCTCTGTTCTCGGATCAATCTTCGCCTTCGACTCCACCTTGATCTAATATCCTTTTCCGATGCTGATATT[A/T,C]
GCAAATTTGGTCGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCGGATTTGCTGTGTACCGACTCCGAGCAAGTCTCGCACTCTGCCGT

Reverse complement sequence

ACGGCAGAGTGCGAGACTTGCTCGGAGTCGGTACACAGCAAATCCGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACGACCAAATTTGC[T/A,G]
AATATCAGCATCGGAAAAGGATATTAGATCAAGGTGGAGTCGAAGGCGAAGATTGATCCGAGAACAGAGCAAGAATCGGCTGAAGTCCAGATCGGCTACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.80% 0.04% 0.00% C: 0.02%
All Indica  2759 96.40% 3.50% 0.04% 0.00% C: 0.04%
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 1.10% 98.50% 0.37% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 97.80% 2.10% 0.00% 0.00% C: 0.11%
Indica Intermediate  786 93.40% 6.60% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 27.80% 72.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917631772 A -> T LOC_Os09g29000.1 upstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> T LOC_Os09g29010.1 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> T LOC_Os09g29030.1 upstream_gene_variant ; 3853.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> T LOC_Os09g29020.1 downstream_gene_variant ; 2045.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> T LOC_Os09g29000-LOC_Os09g29010 intergenic_region ; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> C LOC_Os09g29000.1 upstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> C LOC_Os09g29010.1 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> C LOC_Os09g29030.1 upstream_gene_variant ; 3853.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> C LOC_Os09g29020.1 downstream_gene_variant ; 2045.0bp to feature; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0917631772 A -> C LOC_Os09g29000-LOC_Os09g29010 intergenic_region ; MODIFIER silent_mutation Average:43.753; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917631772 NA 6.97E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.03E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 4.04E-51 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 7.74E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 8.82E-17 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.39E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 4.38E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.29E-30 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 8.28E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.10E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 4.97E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 6.29E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.70E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 4.15E-07 4.15E-07 mr1444 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 6.45E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 9.95E-06 9.95E-06 mr1452 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 4.48E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 2.19E-25 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 6.96E-06 NA mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 6.79E-07 6.79E-07 mr1623 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.04E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 6.51E-06 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 6.45E-07 NA mr1630 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.39E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.09E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 2.40E-06 NA mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.09E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 3.99E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.24E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 2.85E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 7.99E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.48E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.13E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.76E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 4.66E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 2.85E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 7.19E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.58E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.43E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 3.69E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 5.87E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 8.25E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 6.94E-19 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.14E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.57E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917631772 NA 1.20E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251