\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917191900:

Variant ID: vg0917191900 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 17191900
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.30, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTCTCTGTTCATGTTCATGACATCAGAGGGTTCAAACAGGGTTCACTATGACTTGCTCTTTCGAAGTAATGCATATGTTTCTCAGAAACAAAGCCCA[T/A]
TGTGTCCAACATTGAGTTTCTCTTTTAGAATAATCTTCCAATGTTGCTGCAGTAATAGTTTCAATTCCTTGTCTAGGAAGAAAATTTTTTTCATATCTGA

Reverse complement sequence

TCAGATATGAAAAAAATTTTCTTCCTAGACAAGGAATTGAAACTATTACTGCAGCAACATTGGAAGATTATTCTAAAAGAGAAACTCAATGTTGGACACA[A/T]
TGGGCTTTGTTTCTGAGAAACATATGCATTACTTCGAAAGAGCAAGTCATAGTGAACCCTGTTTGAACCCTCTGATGTCATGAACATGAACAGAGAAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.10% 0.17% 0.00% NA
All Indica  2759 97.60% 2.40% 0.04% 0.00% NA
All Japonica  1512 44.20% 55.50% 0.26% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 72.90% 27.10% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 93.80% 0.40% 0.00% NA
Japonica Intermediate  241 33.60% 65.60% 0.83% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917191900 T -> A LOC_Os09g28320.1 upstream_gene_variant ; 4285.0bp to feature; MODIFIER silent_mutation Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0917191900 T -> A LOC_Os09g28300.1 downstream_gene_variant ; 3522.0bp to feature; MODIFIER silent_mutation Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0917191900 T -> A LOC_Os09g28300.2 downstream_gene_variant ; 3522.0bp to feature; MODIFIER silent_mutation Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0917191900 T -> A LOC_Os09g28310.1 intron_variant ; MODIFIER silent_mutation Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917191900 NA 1.08E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0917191900 NA 3.93E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 9.74E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 2.81E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 1.31E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 3.65E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 3.29E-24 mr1552 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 5.57E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 2.09E-14 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 8.28E-11 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 4.15E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 1.91E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 2.18E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 1.36E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 7.84E-18 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 9.09E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 1.35E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 3.82E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 8.47E-19 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 9.67E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 9.61E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 1.82E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900 NA 3.05E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251