Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917191900:

Variant ID: vg0917191900 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 17191900
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.30, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTTCTCTGTTCATGTTCATGACATCAGAGGGTTCAAACAGGGTTCACTATGACTTGCTCTTTCGAAGTAATGCATATGTTTCTCAGAAACAAAGCCCA[T/A]
TGTGTCCAACATTGAGTTTCTCTTTTAGAATAATCTTCCAATGTTGCTGCAGTAATAGTTTCAATTCCTTGTCTAGGAAGAAAATTTTTTTCATATCTGA

Reverse complement sequence

TCAGATATGAAAAAAATTTTCTTCCTAGACAAGGAATTGAAACTATTACTGCAGCAACATTGGAAGATTATTCTAAAAGAGAAACTCAATGTTGGACACA[A/T]
TGGGCTTTGTTTCTGAGAAACATATGCATTACTTCGAAAGAGCAAGTCATAGTGAACCCTGTTTGAACCCTCTGATGTCATGAACATGAACAGAGAAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	27.10%	0.17%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.04%	0.00%	NA
All Japonica	1512	44.20%	55.50%	0.26%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	72.90%	27.10%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	93.80%	0.40%	0.00%	NA
Japonica Intermediate	241	33.60%	65.60%	0.83%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	62.20%	34.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0917191900	T -> A	LOC_Os09g28320.1	upstream_gene_variant ; 4285.0bp to feature; MODIFIER	silent_mutation	Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0917191900	T -> A	LOC_Os09g28300.1	downstream_gene_variant ; 3522.0bp to feature; MODIFIER	silent_mutation	Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0917191900	T -> A	LOC_Os09g28300.2	downstream_gene_variant ; 3522.0bp to feature; MODIFIER	silent_mutation	Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0917191900	T -> A	LOC_Os09g28310.1	intron_variant ; MODIFIER	silent_mutation	Average:47.381; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0917191900	NA	1.08E-16	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0917191900	NA	3.93E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	9.74E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	2.81E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	1.31E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	3.65E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	3.29E-24	mr1552	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	5.57E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	2.09E-14	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	8.28E-11	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	4.15E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	1.91E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	2.18E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	1.36E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	7.84E-18	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	9.09E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	1.35E-16	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	3.82E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	8.47E-19	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	9.67E-10	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	9.61E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	1.82E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917191900	NA	3.05E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251