\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0917092123:

Variant ID: vg0917092123 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 17092123
Reference Allele: TATATTGATGTTGATGAATCATCAACATCAATATAAlternative Allele: CATATTGATGTTGATGAATCATCAACATCAATATA,T,TATTCATATTGATGTTGATGAATCATCAACATCAATATA
Primary Allele: CATATTGATGTTGATGAATC ATCAACATCAATATASecondary Allele: TATATTGATGTTGATGAATC ATCAACATCAATATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTTTACAGCCTTCTCTACTTCCCAAACAAATGTACCGGGCAGATCATATATACTTCCTTCGTTTCACAATATAAGGTCATTCTAGTATTTTCCATATT[TATATTGATGTTGATGAATCATCAACATCAATATA/CATATTGATGTTGATGAATCATCAACATCAATATA,T,TATTCATATTGATGTTGATGAATCATCAACATCAATATA]
AATATGGAAAATGCTAGAATGACTTATATTGTGAAACGGAGGGAGTACTAATTAATCAGCAATCATTTTATCATCTGTCCATGTCACCAGCTTCAAAGCT

Reverse complement sequence

AGCTTTGAAGCTGGTGACATGGACAGATGATAAAATGATTGCTGATTAATTAGTACTCCCTCCGTTTCACAATATAAGTCATTCTAGCATTTTCCATATT[TATATTGATGTTGATGATTCATCAACATCAATATA/TATATTGATGTTGATGATTCATCAACATCAATATG,A,TATATTGATGTTGATGATTCATCAACATCAATATGAATA]
AATATGGAAAATACTAGAATGACCTTATATTGTGAAACGAAGGAAGTATATATGATCTGCCCGGTACATTTGTTTGGGAAGTAGAGAAGGCTGTAAACTG

Allele Frequencies:

Populations Population SizeFrequency of CATATTGATGTTGATGAATC ATCAACATCAATATA(primary allele) Frequency of TATATTGATGTTGATGAATC ATCAACATCAATATA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 22.90% 2.84% 15.51% TATTCATATTGATGTTGATGAATCATCAACATCAATATA: 0.06%; T: 0.04%
All Indica  2759 97.00% 0.90% 1.27% 0.83% NA
All Japonica  1512 0.90% 67.60% 0.46% 31.02% TATTCATATTGATGTTGATGAATCATCAACATCAATATA: 0.07%
Aus  269 7.40% 0.40% 31.97% 60.22% NA
Indica I  595 99.50% 0.20% 0.17% 0.17% NA
Indica II  465 95.90% 3.20% 0.43% 0.43% NA
Indica III  913 97.90% 0.30% 1.31% 0.44% NA
Indica Intermediate  786 94.80% 0.60% 2.54% 2.04% NA
Temperate Japonica  767 0.30% 94.40% 0.00% 5.35% NA
Tropical Japonica  504 1.20% 17.10% 0.60% 81.15% NA
Japonica Intermediate  241 2.10% 88.00% 1.66% 7.88% TATTCATATTGATGTTGATGAATCATCAACATCAATATA: 0.41%
VI/Aromatic  96 26.00% 7.30% 1.04% 63.54% TATTCATATTGATGTTGATGAATCATCAACATCAATATA: 2.08%
Intermediate  90 43.30% 28.90% 5.56% 20.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> CATATTGATGTTGATGAATCATCAACATCA ATATA LOC_Os09g28180.1 3_prime_UTR_variant ; 473.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> CATATTGATGTTGATGAATCATCAACATCA ATATA LOC_Os09g28170.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> DEL N N silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> T LOC_Os09g28180.1 3_prime_UTR_variant ; 439.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> T LOC_Os09g28170.1 upstream_gene_variant ; 801.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> TATTCATATTGATGTTGATGAATCATCAAC ATCAATATA LOC_Os09g28180.1 3_prime_UTR_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N
vg0917092123 TATATTGATGTTGATGAATCATCAACATCAATATA -> TATTCATATTGATGTTGATGAATCATCAAC ATCAATATA LOC_Os09g28170.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:88.02; most accessible tissue: Minghui63 root, score: 98.829 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0917092123 TATAT* CATAT* -0.02 -0.04 -0.04 -0.01 -0.01 0.0
vg0917092123 TATAT* T -0.52 -0.56 -0.21 0.19 -0.03 0.12
vg0917092123 TATAT* TATTC* -0.07 -0.25 0.0 -0.12 -0.11 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0917092123 NA 1.67E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.71E-28 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.78E-49 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.22E-40 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.87E-23 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.04E-31 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.13E-33 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.25E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 5.46E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.70E-63 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.91E-35 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.66E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.67E-40 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.29E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.86E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.11E-32 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.94E-30 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.98E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.81E-51 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.09E-66 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.29E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.10E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.86E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.29E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.69E-31 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.03E-42 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 7.74E-48 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.70E-42 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.91E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.02E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.82E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.80E-42 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.67E-39 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.04E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.94E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.72E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.87E-62 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.23E-58 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 5.09E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.97E-63 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.17E-48 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.32E-63 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.66E-36 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 4.64E-35 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.36E-71 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.37E-80 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.05E-59 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 6.23E-71 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.21E-38 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 7.92E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.15E-17 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.40E-44 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 5.92E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.64E-38 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.75E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.54E-53 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.82E-58 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.08E-39 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.02E-43 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 9.29E-26 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 8.56E-82 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 7.72E-41 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.88E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 3.52E-53 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 7.03E-47 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.53E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.21E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 5.15E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.32E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.00E-50 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.57E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.01E-40 mr1878_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 7.73E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 2.44E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.74E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0917092123 NA 1.31E-96 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251