\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916986888:

Variant ID: vg0916986888 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16986888
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTGCTATGTTTTATACTTCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCATATTCATATTGATGTTAATGAATCTAGATAAATATATATGT[C/T]
TAGATTCATCAACATCGCTATGAATGTGGAAAATGCTAGAAATGACTTACATTGTAAAACGGATGGAGTAGTAACTTATCAAAACATCATATAGTGGGAA

Reverse complement sequence

TTCCCACTATATGATGTTTTGATAAGTTACTACTCCATCCGTTTTACAATGTAAGTCATTTCTAGCATTTTCCACATTCATAGCGATGTTGATGAATCTA[G/A]
ACATATATATTTATCTAGATTCATTAACATCAATATGAATATGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTATAAAACATAGCAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.10% 0.00% 0.00% NA
All Indica  2759 81.20% 18.80% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 46.70% 53.30% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 78.80% 21.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916986888 C -> T LOC_Os09g27950.1 upstream_gene_variant ; 2910.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27960.1 downstream_gene_variant ; 1051.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27970.1 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27960.2 downstream_gene_variant ; 2920.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27970.2 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27970.3 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27970.4 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27970.5 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0916986888 C -> T LOC_Os09g27950-LOC_Os09g27960 intergenic_region ; MODIFIER silent_mutation Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916986888 NA 3.25E-09 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 4.60E-06 5.81E-14 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 6.98E-08 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 4.47E-07 8.19E-16 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 6.80E-06 6.65E-10 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 1.20E-10 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 1.24E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 3.52E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 1.35E-15 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 8.01E-08 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 4.72E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888 NA 6.32E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251