\
| Variant ID: vg0916986888 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16986888 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTTGCTATGTTTTATACTTCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCATATTCATATTGATGTTAATGAATCTAGATAAATATATATGT[C/T]
TAGATTCATCAACATCGCTATGAATGTGGAAAATGCTAGAAATGACTTACATTGTAAAACGGATGGAGTAGTAACTTATCAAAACATCATATAGTGGGAA
TTCCCACTATATGATGTTTTGATAAGTTACTACTCCATCCGTTTTACAATGTAAGTCATTTCTAGCATTTTCCACATTCATAGCGATGTTGATGAATCTA[G/A]
ACATATATATTTATCTAGATTCATTAACATCAATATGAATATGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTATAAAACATAGCAACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916986888 | C -> T | LOC_Os09g27950.1 | upstream_gene_variant ; 2910.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27960.1 | downstream_gene_variant ; 1051.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27970.1 | downstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27960.2 | downstream_gene_variant ; 2920.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27970.2 | downstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27970.3 | downstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27970.4 | downstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27970.5 | downstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0916986888 | C -> T | LOC_Os09g27950-LOC_Os09g27960 | intergenic_region ; MODIFIER | silent_mutation | Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916986888 | NA | 3.25E-09 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | 4.60E-06 | 5.81E-14 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 6.98E-08 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | 4.47E-07 | 8.19E-16 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | 6.80E-06 | 6.65E-10 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 1.20E-10 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 1.24E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 3.52E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 1.35E-15 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 8.01E-08 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 4.72E-10 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916986888 | NA | 6.32E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |