Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916986888:

Variant ID: vg0916986888 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16986888
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTTGCTATGTTTTATACTTCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCATATTCATATTGATGTTAATGAATCTAGATAAATATATATGT[C/T]
TAGATTCATCAACATCGCTATGAATGTGGAAAATGCTAGAAATGACTTACATTGTAAAACGGATGGAGTAGTAACTTATCAAAACATCATATAGTGGGAA

Reverse complement sequence

TTCCCACTATATGATGTTTTGATAAGTTACTACTCCATCCGTTTTACAATGTAAGTCATTTCTAGCATTTTCCACATTCATAGCGATGTTGATGAATCTA[G/A]
ACATATATATTTATCTAGATTCATTAACATCAATATGAATATGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTATAAAACATAGCAACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.10%	0.00%	0.00%	NA
All Indica	2759	81.20%	18.80%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	46.70%	53.30%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	78.80%	21.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916986888	C -> T	LOC_Os09g27950.1	upstream_gene_variant ; 2910.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27960.1	downstream_gene_variant ; 1051.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27970.1	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27960.2	downstream_gene_variant ; 2920.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27970.2	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27970.3	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27970.4	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27970.5	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0916986888	C -> T	LOC_Os09g27950-LOC_Os09g27960	intergenic_region ; MODIFIER	silent_mutation	Average:56.049; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916986888	NA	3.25E-09	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	4.60E-06	5.81E-14	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	6.98E-08	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	4.47E-07	8.19E-16	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	6.80E-06	6.65E-10	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	1.20E-10	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	1.24E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	3.52E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	1.35E-15	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	8.01E-08	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	4.72E-10	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916986888	NA	6.32E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251