Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916777400:

Variant ID: vg0916777400 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16777400
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATGTATTAGGGGCATTTTCGTCATTTTACCACTTAGTTAACGGTGTTAACTCGTCTTAACGGAATAGGGTCATCTTTCCTATTCGATTTTGAAAAACA[G/A]
GGTTAAATTAGTAGTTAGCTTTTAAAATAGGGTTAAATAAGCAATTGCCCCAAGATATAATGTCTCAATCCCATTAGGCAAACATGTCCGGAGAGTGTAG

Reverse complement sequence

CTACACTCTCCGGACATGTTTGCCTAATGGGATTGAGACATTATATCTTGGGGCAATTGCTTATTTAACCCTATTTTAAAAGCTAACTACTAATTTAACC[C/T]
TGTTTTTCAAAATCGAATAGGAAAGATGACCCTATTCCGTTAAGACGAGTTAACACCGTTAACTAAGTGGTAAAATGACGAAAATGCCCCTAATACATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	41.50%	2.05%	1.57%	NA
All Indica	2759	23.90%	70.00%	3.44%	2.65%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	51.90%	45.70%	0.84%	1.51%	NA
Indica II	465	12.90%	79.40%	3.44%	4.30%	NA
Indica III	913	5.80%	85.20%	5.59%	3.40%	NA
Indica Intermediate	786	30.20%	65.30%	2.93%	1.65%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	24.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916777400	G -> DEL	N	N	silent_mutation	Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0916777400	G -> A	LOC_Os09g27610.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0916777400	G -> A	LOC_Os09g27590-LOC_Os09g27610	intergenic_region ; MODIFIER	silent_mutation	Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916777400	6.03E-06	2.83E-17	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	1.38E-06	2.63E-11	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	1.33E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	6.37E-10	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	6.54E-08	NA	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	1.61E-07	3.14E-12	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	1.59E-09	NA	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	5.70E-09	1.62E-14	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	2.21E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	3.07E-09	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	7.37E-06	4.74E-18	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	4.68E-11	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	2.13E-18	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	7.56E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	1.47E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	2.64E-07	NA	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	3.34E-06	2.32E-08	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	5.08E-07	NA	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	3.15E-06	1.98E-14	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400	NA	2.29E-11	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251