\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916777400:

Variant ID: vg0916777400 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16777400
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATGTATTAGGGGCATTTTCGTCATTTTACCACTTAGTTAACGGTGTTAACTCGTCTTAACGGAATAGGGTCATCTTTCCTATTCGATTTTGAAAAACA[G/A]
GGTTAAATTAGTAGTTAGCTTTTAAAATAGGGTTAAATAAGCAATTGCCCCAAGATATAATGTCTCAATCCCATTAGGCAAACATGTCCGGAGAGTGTAG

Reverse complement sequence

CTACACTCTCCGGACATGTTTGCCTAATGGGATTGAGACATTATATCTTGGGGCAATTGCTTATTTAACCCTATTTTAAAAGCTAACTACTAATTTAACC[C/T]
TGTTTTTCAAAATCGAATAGGAAAGATGACCCTATTCCGTTAAGACGAGTTAACACCGTTAACTAAGTGGTAAAATGACGAAAATGCCCCTAATACATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 41.50% 2.05% 1.57% NA
All Indica  2759 23.90% 70.00% 3.44% 2.65% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 51.90% 45.70% 0.84% 1.51% NA
Indica II  465 12.90% 79.40% 3.44% 4.30% NA
Indica III  913 5.80% 85.20% 5.59% 3.40% NA
Indica Intermediate  786 30.20% 65.30% 2.93% 1.65% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916777400 G -> DEL N N silent_mutation Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0916777400 G -> A LOC_Os09g27610.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0916777400 G -> A LOC_Os09g27590-LOC_Os09g27610 intergenic_region ; MODIFIER silent_mutation Average:60.979; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916777400 6.03E-06 2.83E-17 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 1.38E-06 2.63E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 1.33E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 6.37E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 6.54E-08 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 1.61E-07 3.14E-12 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 1.59E-09 NA mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 5.70E-09 1.62E-14 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 2.21E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 3.07E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 7.37E-06 4.74E-18 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 4.68E-11 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 2.13E-18 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 7.56E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 1.47E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 2.64E-07 NA mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 3.34E-06 2.32E-08 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 5.08E-07 NA mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 3.15E-06 1.98E-14 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916777400 NA 2.29E-11 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251