\
| Variant ID: vg0916685790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16685790 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 227. )
CAAGGCAAGTCATGCAATACAATTGATCATATTGTACCCAATTTACAAATATCCCGCATTTCTATTAAATGTTGCATTCTTTTACAATATCATGTGGGAT[A/G]
GGTCCTATTATTCAGCCATATATTGTTTACCATATGCCATTGATAACTTGGGTATCAAAATGATTAGATGTTGGTTTAGGAAATACACTAAATGGTGGGC
GCCCACCATTTAGTGTATTTCCTAAACCAACATCTAATCATTTTGATACCCAAGTTATCAATGGCATATGGTAAACAATATATGGCTGAATAATAGGACC[T/C]
ATCCCACATGATATTGTAAAAGAATGCAACATTTAATAGAAATGCGGGATATTTGTAAATTGGGTACAATATGATCAATTGTATTGCATGACTTGCCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.40% | 0.13% | 0.04% | NA |
| All Indica | 2759 | 98.90% | 0.90% | 0.14% | 0.07% | NA |
| All Japonica | 1512 | 3.60% | 96.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.50% | 0.34% | 0.34% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.50% | 96.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916685790 | A -> G | LOC_Os09g27460.1 | upstream_gene_variant ; 4427.0bp to feature; MODIFIER | silent_mutation | Average:37.281; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0916685790 | A -> G | LOC_Os09g27470.1 | upstream_gene_variant ; 600.0bp to feature; MODIFIER | silent_mutation | Average:37.281; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0916685790 | A -> G | LOC_Os09g27470-LOC_Os09g27480 | intergenic_region ; MODIFIER | silent_mutation | Average:37.281; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0916685790 | A -> DEL | N | N | silent_mutation | Average:37.281; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916685790 | NA | 2.51E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0916685790 | NA | 1.47E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 7.03E-105 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 6.74E-08 | 6.74E-08 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 5.04E-103 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 1.55E-07 | 1.55E-07 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 6.06E-72 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 7.31E-66 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.83E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.01E-45 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.03E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.31E-78 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.98E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.60E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.21E-23 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.31E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.84E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 7.36E-48 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.99E-49 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.03E-45 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.93E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.64E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.57E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.49E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.54E-88 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.30E-36 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.28E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.21E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.46E-37 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.98E-43 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.04E-57 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 5.42E-70 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 7.44E-32 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.67E-36 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.34E-59 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.56E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.41E-26 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 7.91E-90 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.26E-73 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.33E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.74E-21 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 8.73E-37 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.77E-53 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.47E-71 | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.77E-76 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.72E-27 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.12E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.50E-51 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 4.26E-06 | 1.12E-63 | mr1962 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 1.80E-06 | 2.41E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 2.32E-06 | 2.32E-06 | mr1987 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 1.74E-07 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 8.76E-102 | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.10E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 9.85E-99 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 9.43E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 3.84E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.88E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 4.75E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 2.86E-99 | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | NA | 5.86E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916685790 | 1.35E-06 | 3.71E-74 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |