Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916606575:

Variant ID: vg0916606575 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16606575
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGCAGCGATGACATGTCGTCCTCCGATTGGTTGGCCACGTTGCCACAATAATTAACTTAATCAACATGCATTAGCTAGCTTGTTGCCATCCAACAGCA[C/T]
TGGCTCGCCATCCTCCCGTCGTCCTTCCTCTGTACTGCAGCCATACTTGCCTCCATCGTCATCCGCTGGTTTCGACGCCATGCGTGATGCTTGACCTCCG

Reverse complement sequence

CGGAGGTCAAGCATCACGCATGGCGTCGAAACCAGCGGATGACGATGGAGGCAAGTATGGCTGCAGTACAGAGGAAGGACGACGGGAGGATGGCGAGCCA[G/A]
TGCTGTTGGATGGCAACAAGCTAGCTAATGCATGTTGATTAAGTTAATTATTGTGGCAACGTGGCCAACCAATCGGAGGACGACATGTCATCGCTGCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.20%	0.04%	0.00%	NA
All Indica	2759	82.60%	17.30%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	52.30%	47.70%	0.00%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	79.40%	20.40%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916606575	C -> T	LOC_Os09g27300.1	upstream_gene_variant ; 3668.0bp to feature; MODIFIER	silent_mutation	Average:47.515; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0916606575	C -> T	LOC_Os09g27320.1	upstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:47.515; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0916606575	C -> T	LOC_Os09g27310.1	intron_variant ; MODIFIER	silent_mutation	Average:47.515; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916606575	NA	2.77E-11	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	4.09E-09	mr1354	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	1.75E-06	1.08E-19	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	9.31E-12	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	1.21E-07	1.02E-20	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	5.30E-06	2.47E-13	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	4.93E-14	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	2.72E-09	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	1.83E-06	NA	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	7.05E-10	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	7.73E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	1.50E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	6.80E-06	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	1.46E-07	1.14E-15	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	6.27E-09	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	5.15E-09	3.16E-26	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	1.47E-06	1.37E-14	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	2.08E-06	3.96E-19	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	6.28E-13	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916606575	NA	6.12E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251