Variant ID: vg0916428525 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 16428525 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )
TTGAAATTTGAACAGATCTCCGCTAAATTCACAACAAAATCTGAAAGTTTTATTACCAGGATCCACCGCTAGGCCCCATTTAAGATAACTGAAATTGATG[A/G]
ATACGCTTATTTTTATAGCTATTTGAAACTATAAACAGATGAATTAACTAGTAATATGTTGAACAGTTGCTTTAGAAAAAATATTTTATAAAACGTATTA
TAATACGTTTTATAAAATATTTTTTCTAAAGCAACTGTTCAACATATTACTAGTTAATTCATCTGTTTATAGTTTCAAATAGCTATAAAAATAAGCGTAT[T/C]
CATCAATTTCAGTTATCTTAAATGGGGCCTAGCGGTGGATCCTGGTAATAAAACTTTCAGATTTTGTTGTGAATTTAGCGGAGATCTGTTCAAATTTCAA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.20% | 10.80% | 0.02% | 0.00% | NA |
All Indica | 2759 | 81.60% | 18.40% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.50% | 4.40% | 0.17% | 0.00% | NA |
Indica II | 465 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0916428525 | A -> G | LOC_Os09g27010.1 | upstream_gene_variant ; 3307.0bp to feature; MODIFIER | silent_mutation | Average:85.537; most accessible tissue: Minghui63 young leaf, score: 93.766 | N | N | N | N |
vg0916428525 | A -> G | LOC_Os09g27010-LOC_Os09g27020 | intergenic_region ; MODIFIER | silent_mutation | Average:85.537; most accessible tissue: Minghui63 young leaf, score: 93.766 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0916428525 | NA | 7.04E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 1.23E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 2.19E-08 | mr1671 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 2.24E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 5.68E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 3.33E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0916428525 | NA | 1.33E-07 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |