\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916300567:

Variant ID: vg0916300567 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16300567
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTCTTTTACACGCACGTTTTTCAAACGGCTAAACGGTGCCGTTTTTGTAAAAGTTTATATACAGAAGTTTTTTTAAAAAAATCATATTGATCATTTTTT[A/T]
AAAAAAAATTAGCTAATACTTGATTAATTATATGCTAATGAGTGCTTCGTTATACATGGCGGAGAGAAGGGTTTCCCAACCCTCCTTCAAACACTGCCTT

Reverse complement sequence

AAGGCAGTGTTTGAAGGAGGGTTGGGAAACCCTTCTCTCCGCCATGTATAACGAAGCACTCATTAGCATATAATTAATCAAGTATTAGCTAATTTTTTTT[T/A]
AAAAAATGATCAATATGATTTTTTTAAAAAAACTTCTGTATATAAACTTTTACAAAAACGGCACCGTTTAGCCGTTTGAAAAACGTGCGTGTAAAAGACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 39.50% 0.74% 0.00% NA
All Indica  2759 95.00% 4.80% 0.22% 0.00% NA
All Japonica  1512 5.30% 93.20% 1.52% 0.00% NA
Aus  269 21.20% 78.80% 0.00% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 97.00% 2.80% 0.11% 0.00% NA
Indica Intermediate  786 90.70% 8.90% 0.38% 0.00% NA
Temperate Japonica  767 4.80% 93.20% 1.96% 0.00% NA
Tropical Japonica  504 4.80% 94.60% 0.60% 0.00% NA
Japonica Intermediate  241 7.90% 90.00% 2.07% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 37.80% 55.60% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916300567 A -> T LOC_Os09g26820.1 downstream_gene_variant ; 3338.0bp to feature; MODIFIER silent_mutation Average:73.544; most accessible tissue: Callus, score: 94.065 N N N N
vg0916300567 A -> T LOC_Os09g26830.1 downstream_gene_variant ; 177.0bp to feature; MODIFIER silent_mutation Average:73.544; most accessible tissue: Callus, score: 94.065 N N N N
vg0916300567 A -> T LOC_Os09g26820-LOC_Os09g26830 intergenic_region ; MODIFIER silent_mutation Average:73.544; most accessible tissue: Callus, score: 94.065 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0916300567 A T -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916300567 NA 6.58E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 6.11E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 2.49E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 1.97E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 3.91E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 1.13E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 1.86E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 8.94E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 4.39E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 5.13E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 1.97E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 2.79E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 6.41E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 8.43E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 2.71E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 2.66E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 4.85E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 5.04E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 2.03E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 4.26E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916300567 NA 1.27E-14 mr1950_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251