\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916266442:

Variant ID: vg0916266442 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16266442
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAACTTTTAAAATTTTTTCATAAATTTTTTAAATAAGACGGACGGTTAAACGTTGGTACGGAAACTTATGGCTGCACTTATAATGGGACGGAGGAAGT[A/T]
GTAATTTATGCTTGTCATTAATTTTGTTGTTTAAGCCCATGTTGTAGTGATTTAGCAAAATCTGACAGTTTTGCATTTTACTAATAATATATTCCTCCAT

Reverse complement sequence

ATGGAGGAATATATTATTAGTAAAATGCAAAACTGTCAGATTTTGCTAAATCACTACAACATGGGCTTAAACAACAAAATTAATGACAAGCATAAATTAC[T/A]
ACTTCCTCCGTCCCATTATAAGTGCAGCCATAAGTTTCCGTACCAACGTTTAACCGTCCGTCTTATTTAAAAAATTTATGAAAAAATTTTAAAAGTTAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 48.90% 0.19% 0.00% NA
All Indica  2759 18.80% 80.90% 0.29% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 42.20% 57.60% 0.17% 0.00% NA
Indica II  465 6.50% 93.50% 0.00% 0.00% NA
Indica III  913 7.40% 92.20% 0.33% 0.00% NA
Indica Intermediate  786 21.80% 77.70% 0.51% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916266442 A -> T LOC_Os09g26770.2 downstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:52.126; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0916266442 A -> T LOC_Os09g26770.3 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:52.126; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0916266442 A -> T LOC_Os09g26770-LOC_Os09g26780 intergenic_region ; MODIFIER silent_mutation Average:52.126; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916266442 NA 2.47E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 1.06E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.46E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.43E-07 mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.63E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 8.54E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 3.32E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 6.95E-09 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 4.20E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.27E-10 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 4.59E-11 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 6.88E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 1.88E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 7.80E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 3.74E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.76E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 4.66E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 2.51E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 4.58E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 1.05E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 5.73E-10 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 1.42E-10 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916266442 NA 6.47E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251