\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916248949:

Variant ID: vg0916248949 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16248949
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATCATCTCTATTGCTGCCAATCGTCATTACCACCGGTTGCATTTGTTGTCGTCGATTGTTTCCTGTATTTTCATGATTGGAGGATTTCGCCATCGTC[G/A]
TTGATGCGCGTCTACATCTTCATCATTGGCTTGTTCTCATCGTCACCGACTATTGGCTCGTCTGTCACCGACTGATTATTTCGCCACCATGGCTGCACGA

Reverse complement sequence

TCGTGCAGCCATGGTGGCGAAATAATCAGTCGGTGACAGACGAGCCAATAGTCGGTGACGATGAGAACAAGCCAATGATGAAGATGTAGACGCGCATCAA[C/T]
GACGATGGCGAAATCCTCCAATCATGAAAATACAGGAAACAATCGACGACAACAAATGCAACCGGTGGTAATGACGATTGGCAGCAATAGAGATGATCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.40% 0.06% 0.21% NA
All Indica  2759 83.20% 16.40% 0.07% 0.33% NA
All Japonica  1512 0.30% 99.60% 0.07% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 59.70% 40.00% 0.00% 0.34% NA
Indica II  465 93.80% 6.00% 0.00% 0.22% NA
Indica III  913 95.70% 4.10% 0.00% 0.22% NA
Indica Intermediate  786 80.20% 19.10% 0.25% 0.51% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 99.80% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916248949 G -> DEL N N silent_mutation Average:39.842; most accessible tissue: Callus, score: 59.582 N N N N
vg0916248949 G -> A LOC_Os09g26750.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:39.842; most accessible tissue: Callus, score: 59.582 N N N N
vg0916248949 G -> A LOC_Os09g26740.1 downstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:39.842; most accessible tissue: Callus, score: 59.582 N N N N
vg0916248949 G -> A LOC_Os09g26760.1 downstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:39.842; most accessible tissue: Callus, score: 59.582 N N N N
vg0916248949 G -> A LOC_Os09g26750-LOC_Os09g26760 intergenic_region ; MODIFIER silent_mutation Average:39.842; most accessible tissue: Callus, score: 59.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916248949 NA 1.34E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 NA 3.06E-13 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 NA 3.93E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 NA 3.94E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 NA 7.43E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 1.20E-07 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 5.70E-07 6.89E-12 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 4.16E-08 NA mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 2.03E-07 1.83E-14 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 9.05E-07 6.59E-12 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 NA 8.38E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 5.43E-06 1.24E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 7.40E-07 NA mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 5.78E-06 3.91E-09 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 1.04E-08 NA mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 1.51E-08 8.19E-16 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 8.59E-07 NA mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949 7.28E-08 1.34E-13 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251