Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916248949:

Variant ID: vg0916248949 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16248949
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATCATCTCTATTGCTGCCAATCGTCATTACCACCGGTTGCATTTGTTGTCGTCGATTGTTTCCTGTATTTTCATGATTGGAGGATTTCGCCATCGTC[G/A]
TTGATGCGCGTCTACATCTTCATCATTGGCTTGTTCTCATCGTCACCGACTATTGGCTCGTCTGTCACCGACTGATTATTTCGCCACCATGGCTGCACGA

Reverse complement sequence

TCGTGCAGCCATGGTGGCGAAATAATCAGTCGGTGACAGACGAGCCAATAGTCGGTGACGATGAGAACAAGCCAATGATGAAGATGTAGACGCGCATCAA[C/T]
GACGATGGCGAAATCCTCCAATCATGAAAATACAGGAAACAATCGACGACAACAAATGCAACCGGTGGTAATGACGATTGGCAGCAATAGAGATGATCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	49.40%	0.06%	0.21%	NA
All Indica	2759	83.20%	16.40%	0.07%	0.33%	NA
All Japonica	1512	0.30%	99.60%	0.07%	0.00%	NA
Aus	269	17.50%	82.50%	0.00%	0.00%	NA
Indica I	595	59.70%	40.00%	0.00%	0.34%	NA
Indica II	465	93.80%	6.00%	0.00%	0.22%	NA
Indica III	913	95.70%	4.10%	0.00%	0.22%	NA
Indica Intermediate	786	80.20%	19.10%	0.25%	0.51%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	99.80%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	68.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916248949	G -> DEL	N	N	silent_mutation	Average:39.842; most accessible tissue: Callus, score: 59.582	N	N	N	N
vg0916248949	G -> A	LOC_Os09g26750.1	upstream_gene_variant ; 1149.0bp to feature; MODIFIER	silent_mutation	Average:39.842; most accessible tissue: Callus, score: 59.582	N	N	N	N
vg0916248949	G -> A	LOC_Os09g26740.1	downstream_gene_variant ; 2635.0bp to feature; MODIFIER	silent_mutation	Average:39.842; most accessible tissue: Callus, score: 59.582	N	N	N	N
vg0916248949	G -> A	LOC_Os09g26760.1	downstream_gene_variant ; 3224.0bp to feature; MODIFIER	silent_mutation	Average:39.842; most accessible tissue: Callus, score: 59.582	N	N	N	N
vg0916248949	G -> A	LOC_Os09g26750-LOC_Os09g26760	intergenic_region ; MODIFIER	silent_mutation	Average:39.842; most accessible tissue: Callus, score: 59.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916248949	NA	1.34E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	NA	3.06E-13	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	NA	3.93E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	NA	3.94E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	NA	7.43E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	1.20E-07	NA	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	5.70E-07	6.89E-12	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	4.16E-08	NA	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	2.03E-07	1.83E-14	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	9.05E-07	6.59E-12	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	NA	8.38E-15	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	5.43E-06	1.24E-08	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	7.40E-07	NA	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	5.78E-06	3.91E-09	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	1.04E-08	NA	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	1.51E-08	8.19E-16	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	8.59E-07	NA	mr1860_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916248949	7.28E-08	1.34E-13	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251