Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916243027:

Variant ID: vg0916243027 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 16243027
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTCCGTCGCCGCCGACTGGTGTCCTCGCCTATACGGTTGGTTGGTCACACCACTGTTCATGGGCGTCCACATCTTCACCGACCGGCTGGCCTTCGCCG[T/C]
CGCCGACTGGTGTTTCCGCCTGTACGGCTGGCCTATTATGCCGCTGTTGTTGGGCGTCTATGACTTCACCGCCGGCCTGCCTTCGCCGCCGTCGACTGGT

Reverse complement sequence

ACCAGTCGACGGCGGCGAAGGCAGGCCGGCGGTGAAGTCATAGACGCCCAACAACAGCGGCATAATAGGCCAGCCGTACAGGCGGAAACACCAGTCGGCG[A/G]
CGGCGAAGGCCAGCCGGTCGGTGAAGATGTGGACGCCCATGAACAGTGGTGTGACCAACCAACCGTATAGGCGAGGACACCAGTCGGCGGCGACGGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	24.90%	23.89%	12.17%	NA
All Indica	2759	6.40%	41.50%	36.75%	15.40%	NA
All Japonica	1512	86.40%	0.10%	4.76%	8.73%	NA
Aus	269	82.90%	6.70%	8.55%	1.86%	NA
Indica I	595	3.90%	44.90%	26.05%	25.21%	NA
Indica II	465	6.50%	27.70%	49.03%	16.77%	NA
Indica III	913	3.70%	49.50%	39.65%	7.12%	NA
Indica Intermediate	786	11.30%	37.70%	34.22%	16.79%	NA
Temperate Japonica	767	96.50%	0.00%	2.74%	0.78%	NA
Tropical Japonica	504	74.80%	0.40%	7.54%	17.26%	NA
Japonica Intermediate	241	78.40%	0.00%	5.39%	16.18%	NA
VI/Aromatic	96	85.40%	2.10%	4.17%	8.33%	NA
Intermediate	90	62.20%	14.40%	17.78%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0916243027	T -> DEL	N	N	silent_mutation	Average:18.647; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0916243027	T -> C	LOC_Os09g26730.1	upstream_gene_variant ; 2234.0bp to feature; MODIFIER	silent_mutation	Average:18.647; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0916243027	T -> C	LOC_Os09g26740.1	upstream_gene_variant ; 2763.0bp to feature; MODIFIER	silent_mutation	Average:18.647; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0916243027	T -> C	LOC_Os09g26750.1	downstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:18.647; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0916243027	T -> C	LOC_Os09g26730-LOC_Os09g26740	intergenic_region ; MODIFIER	silent_mutation	Average:18.647; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0916243027	NA	2.26E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	8.88E-07	NA	mr1276	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	7.28E-07	7.28E-07	mr1276	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	3.74E-07	4.18E-18	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	8.64E-06	7.75E-12	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	6.02E-07	1.26E-20	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	4.90E-07	1.09E-15	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	7.65E-06	mr1744	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	6.98E-06	mr1803	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	8.00E-07	2.70E-17	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	4.39E-06	9.02E-12	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	3.41E-08	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	3.12E-14	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	3.90E-09	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	2.00E-19	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	1.06E-12	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	1.72E-16	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916243027	NA	5.94E-12	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251