\
| Variant ID: vg0916105872 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16105872 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGATTACACTATATGATCTACTTCCATAAAGTATAAATTCGCGATGTAGAAAAGAGGTCACTACCACATGACATATCAAATACTCCCTCCGTTTTAAAAT[G/A]
TTTGACACCGTTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAAATTTGTGAAATATGTAAAACTATATGTGTACATGAAAGTATATTTAA
TTAAATATACTTTCATGTACACATATAGTTTTACATATTTCACAAATTTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGGTGTCAAA[C/T]
ATTTTAAAACGGAGGGAGTATTTGATATGTCATGTGGTAGTGACCTCTTTTCTACATCGCGAATTTATACTTTATGGAAGTAGATCATATAGTGTAATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 6.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916105872 | G -> A | LOC_Os09g26580.1 | downstream_gene_variant ; 3051.0bp to feature; MODIFIER | silent_mutation | Average:31.48; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0916105872 | G -> A | LOC_Os09g26580-LOC_Os09g26590 | intergenic_region ; MODIFIER | silent_mutation | Average:31.48; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916105872 | NA | 8.05E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 1.00E-07 | 3.09E-19 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 2.78E-06 | 2.64E-13 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 1.45E-11 | 5.45E-26 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 1.74E-09 | 8.38E-19 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 1.07E-06 | 5.54E-17 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 9.44E-06 | 3.46E-11 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 9.04E-07 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 3.70E-17 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 2.60E-11 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 3.24E-07 | 5.36E-27 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 1.39E-16 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | 2.45E-06 | 3.71E-20 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 8.36E-13 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 2.33E-08 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916105872 | NA | 3.90E-07 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |