\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916047534:

Variant ID: vg0916047534 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16047534
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAAGCTTTGTGTTCATCCATCTAGTGTGTTAGAGGGTTGATTAGCCAAGAGTCAAGTGCATTGCTTCCATTATAGAGCTAGTGTGGCACTTGATTGAT[C/T]
ATCTCCACGCCGGGTCATTGCTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGAGTTGCCCGGTGACCTCTCCGAGAAGATTGTGGAG

Reverse complement sequence

CTCCACAATCTTCTCGGAGAGGTCACCGGGCAACTCCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGCAATGACCCGGCGTGGAGAT[G/A]
ATCAATCAAGTGCCACACTAGCTCTATAATGGAAGCAATGCACTTGACTCTTGGCTAATCAACCCTCTAACACACTAGATGGATGAACACAAAGCTTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 6.30% 2.16% 49.24% NA
All Indica  2759 9.90% 10.40% 3.66% 76.04% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.66% NA
Aus  269 26.40% 1.90% 0.00% 71.75% NA
Indica I  595 8.20% 33.40% 6.05% 52.27% NA
Indica II  465 13.30% 1.90% 3.66% 81.08% NA
Indica III  913 5.90% 0.50% 2.19% 91.35% NA
Indica Intermediate  786 13.70% 9.40% 3.56% 73.28% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 67.80% 3.30% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916047534 C -> DEL N N silent_mutation Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0916047534 C -> T LOC_Os09g26540.1 upstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0916047534 C -> T LOC_Os09g26550.2 upstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0916047534 C -> T LOC_Os09g26540.2 upstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0916047534 C -> T LOC_Os09g26540-LOC_Os09g26550 intergenic_region ; MODIFIER silent_mutation Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916047534 NA 5.22E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 4.25E-10 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 1.99E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 7.65E-11 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 1.33E-07 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 1.03E-11 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 4.67E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 3.91E-06 3.91E-06 mr1966 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 4.12E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 2.96E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 2.33E-06 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 1.21E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 1.21E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916047534 NA 2.12E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251