\
| Variant ID: vg0916047534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 16047534 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTAAGCTTTGTGTTCATCCATCTAGTGTGTTAGAGGGTTGATTAGCCAAGAGTCAAGTGCATTGCTTCCATTATAGAGCTAGTGTGGCACTTGATTGAT[C/T]
ATCTCCACGCCGGGTCATTGCTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGGCTTGTGGAGGAGTTGCCCGGTGACCTCTCCGAGAAGATTGTGGAG
CTCCACAATCTTCTCGGAGAGGTCACCGGGCAACTCCTCCACAAGCCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGCAATGACCCGGCGTGGAGAT[G/A]
ATCAATCAAGTGCCACACTAGCTCTATAATGGAAGCAATGCACTTGACTCTTGGCTAATCAACCCTCTAACACACTAGATGGATGAACACAAAGCTTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 6.30% | 2.16% | 49.24% | NA |
| All Indica | 2759 | 9.90% | 10.40% | 3.66% | 76.04% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.00% | 0.66% | NA |
| Aus | 269 | 26.40% | 1.90% | 0.00% | 71.75% | NA |
| Indica I | 595 | 8.20% | 33.40% | 6.05% | 52.27% | NA |
| Indica II | 465 | 13.30% | 1.90% | 3.66% | 81.08% | NA |
| Indica III | 913 | 5.90% | 0.50% | 2.19% | 91.35% | NA |
| Indica Intermediate | 786 | 13.70% | 9.40% | 3.56% | 73.28% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 3.30% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0916047534 | C -> DEL | N | N | silent_mutation | Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0916047534 | C -> T | LOC_Os09g26540.1 | upstream_gene_variant ; 2067.0bp to feature; MODIFIER | silent_mutation | Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0916047534 | C -> T | LOC_Os09g26550.2 | upstream_gene_variant ; 1604.0bp to feature; MODIFIER | silent_mutation | Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0916047534 | C -> T | LOC_Os09g26540.2 | upstream_gene_variant ; 2067.0bp to feature; MODIFIER | silent_mutation | Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0916047534 | C -> T | LOC_Os09g26540-LOC_Os09g26550 | intergenic_region ; MODIFIER | silent_mutation | Average:19.747; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0916047534 | NA | 5.22E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 4.25E-10 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 1.99E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 7.65E-11 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 1.33E-07 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 1.03E-11 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 4.67E-09 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | 3.91E-06 | 3.91E-06 | mr1966 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 4.12E-06 | mr1348_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 2.96E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 2.33E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 1.21E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 1.21E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0916047534 | NA | 2.12E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |