\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916036241:

Variant ID: vg0916036241 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16036241
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAAAAAATGATATATTGTGTGTATTTACTAAAACTTACATCATGAAAAAAAAGAATTTCAGCAAATTACCTCCATTACAAATTACTGATCGAAATTTC[A/G]
TTAATTTCGATCGGAATTTCGCCAAAACTGACCGGTTTTCGAGAACTTATCGGCAACTTAAGGAATTTGTATTCAAATTTTAGTTTATGAAATTTGTTCG

Reverse complement sequence

CGAACAAATTTCATAAACTAAAATTTGAATACAAATTCCTTAAGTTGCCGATAAGTTCTCGAAAACCGGTCAGTTTTGGCGAAATTCCGATCGAAATTAA[T/C]
GAAATTTCGATCAGTAATTTGTAATGGAGGTAATTTGCTGAAATTCTTTTTTTTCATGATGTAAGTTTTAGTAAATACACACAATATATCATTTTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 6.20% 0.47% 52.01% NA
All Indica  2759 8.30% 10.30% 0.72% 80.72% NA
All Japonica  1512 99.30% 0.00% 0.07% 0.66% NA
Aus  269 24.90% 2.60% 0.37% 72.12% NA
Indica I  595 7.60% 33.10% 0.84% 58.49% NA
Indica II  465 10.30% 1.90% 0.86% 86.88% NA
Indica III  913 5.10% 0.50% 0.33% 93.98% NA
Indica Intermediate  786 11.20% 9.30% 1.02% 78.50% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 67.80% 3.30% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916036241 A -> G LOC_Os09g26530.1 upstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:21.355; most accessible tissue: Callus, score: 48.26 N N N N
vg0916036241 A -> G LOC_Os09g26540.1 downstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:21.355; most accessible tissue: Callus, score: 48.26 N N N N
vg0916036241 A -> G LOC_Os09g26540.2 downstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:21.355; most accessible tissue: Callus, score: 48.26 N N N N
vg0916036241 A -> G LOC_Os09g26530-LOC_Os09g26540 intergenic_region ; MODIFIER silent_mutation Average:21.355; most accessible tissue: Callus, score: 48.26 N N N N
vg0916036241 A -> DEL N N silent_mutation Average:21.355; most accessible tissue: Callus, score: 48.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916036241 NA 5.37E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 2.71E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 5.76E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 3.36E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 3.91E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 4.14E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 3.07E-06 2.14E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 1.04E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 4.56E-06 NA mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 3.38E-06 2.14E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 3.25E-06 3.65E-19 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 4.12E-12 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 1.04E-09 2.35E-25 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 2.25E-07 1.46E-17 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 8.50E-06 2.80E-15 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 2.41E-11 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 4.94E-06 NA mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 7.54E-06 NA mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 4.39E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 1.37E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 9.59E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 8.31E-16 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 2.98E-10 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 7.78E-23 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 3.61E-15 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 3.73E-15 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 1.35E-12 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 7.13E-09 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 6.64E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 4.03E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916036241 NA 5.01E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251