Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0915834013:

Variant ID: vg0915834013 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15834013
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCCAAAGTCATGCATAAAAGTCAGTAAGTTACCCGGCCTTATGCTCTCTATTTATGGCCATTGGTTATGTAAAATGTCCACTAGTTTACCAAATCAAA[G/T]
CATTAATTCATATCCTAACCTTAAGTATTTCATCTTCTTTATCCTAGACTCATGTACAGACTTGGTTAGCTTGGCTAACAATGATCACGTGGCTCAAAAA

Reverse complement sequence

TTTTTGAGCCACGTGATCATTGTTAGCCAAGCTAACCAAGTCTGTACATGAGTCTAGGATAAAGAAGATGAAATACTTAAGGTTAGGATATGAATTAATG[C/A]
TTTGATTTGGTAAACTAGTGGACATTTTACATAACCAATGGCCATAAATAGAGAGCATAAGGCCGGGTAACTTACTGACTTTTATGCATGACTTTGGCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	15.00%	1.14%	0.06%	NA
All Indica	2759	99.50%	0.20%	0.25%	0.04%	NA
All Japonica	1512	52.40%	45.10%	2.51%	0.00%	NA
Aus	269	95.90%	0.00%	3.35%	0.74%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.40%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.40%	0.64%	0.13%	NA
Temperate Japonica	767	21.90%	74.40%	3.65%	0.00%	NA
Tropical Japonica	504	93.30%	5.80%	0.99%	0.00%	NA
Japonica Intermediate	241	63.90%	34.00%	2.07%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915834013	G -> DEL	N	N	silent_mutation	Average:51.332; most accessible tissue: Callus, score: 84.006	N	N	N	N
vg0915834013	G -> T	LOC_Os09g26210.1	upstream_gene_variant ; 3855.0bp to feature; MODIFIER	silent_mutation	Average:51.332; most accessible tissue: Callus, score: 84.006	N	N	N	N
vg0915834013	G -> T	LOC_Os09g26210-LOC_Os09g26220	intergenic_region ; MODIFIER	silent_mutation	Average:51.332; most accessible tissue: Callus, score: 84.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915834013	NA	3.84E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0915834013	NA	2.90E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	1.41E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	2.57E-06	NA	mr1546	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	6.15E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	7.93E-09	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	2.62E-08	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	3.44E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	7.90E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	3.44E-06	mr1748	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	2.26E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	1.30E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	1.46E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915834013	NA	1.63E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251