\
| Variant ID: vg0915834013 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15834013 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGCCAAAGTCATGCATAAAAGTCAGTAAGTTACCCGGCCTTATGCTCTCTATTTATGGCCATTGGTTATGTAAAATGTCCACTAGTTTACCAAATCAAA[G/T]
CATTAATTCATATCCTAACCTTAAGTATTTCATCTTCTTTATCCTAGACTCATGTACAGACTTGGTTAGCTTGGCTAACAATGATCACGTGGCTCAAAAA
TTTTTGAGCCACGTGATCATTGTTAGCCAAGCTAACCAAGTCTGTACATGAGTCTAGGATAAAGAAGATGAAATACTTAAGGTTAGGATATGAATTAATG[C/A]
TTTGATTTGGTAAACTAGTGGACATTTTACATAACCAATGGCCATAAATAGAGAGCATAAGGCCGGGTAACTTACTGACTTTTATGCATGACTTTGGCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.80% | 15.00% | 1.14% | 0.06% | NA |
| All Indica | 2759 | 99.50% | 0.20% | 0.25% | 0.04% | NA |
| All Japonica | 1512 | 52.40% | 45.10% | 2.51% | 0.00% | NA |
| Aus | 269 | 95.90% | 0.00% | 3.35% | 0.74% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.40% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 21.90% | 74.40% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 5.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 34.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915834013 | G -> DEL | N | N | silent_mutation | Average:51.332; most accessible tissue: Callus, score: 84.006 | N | N | N | N |
| vg0915834013 | G -> T | LOC_Os09g26210.1 | upstream_gene_variant ; 3855.0bp to feature; MODIFIER | silent_mutation | Average:51.332; most accessible tissue: Callus, score: 84.006 | N | N | N | N |
| vg0915834013 | G -> T | LOC_Os09g26210-LOC_Os09g26220 | intergenic_region ; MODIFIER | silent_mutation | Average:51.332; most accessible tissue: Callus, score: 84.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915834013 | NA | 3.84E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0915834013 | NA | 2.90E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 1.41E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | 2.57E-06 | NA | mr1546 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 6.15E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 7.93E-09 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 2.62E-08 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 3.44E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 7.90E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 3.44E-06 | mr1748 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 2.26E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 1.30E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 1.46E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915834013 | NA | 1.63E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |