Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915584040:

Variant ID: vg0915584040 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 15584040
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCACTGCTGGATCCTTTATGTGTTCCATCTGAACACTGACCTTGATAAAATGTGGAATGACCCTGCTAGGTCCAAGCTAAAAGCAAAAGTATGATACGG[T/A]
GTTAATGCTTAATCCTTAGTTTGTACTTTTAATTCTTGATGAAAAATGATTCTTTGTCATGTTATATGTTTTGAGGATAAGGGGCTGAACCAACTAATCA

Reverse complement sequence

TGATTAGTTGGTTCAGCCCCTTATCCTCAAAACATATAACATGACAAAGAATCATTTTTCATCAAGAATTAAAAGTACAAACTAAGGATTAAGCATTAAC[A/T]
CCGTATCATACTTTTGCTTTTAGCTTGGACCTAGCAGGGTCATTCCACATTTTATCAAGGTCAGTGTTCAGATGGAACACATAAAGGATCCAGCAGTGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.60%	0.11%	0.02%	NA
All Indica	2759	97.50%	2.30%	0.14%	0.04%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	44.60%	55.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.00%	0.17%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	98.20%	1.60%	0.11%	0.00%	NA
Indica Intermediate	786	95.90%	3.80%	0.25%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	68.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0915584040	T -> DEL	N	N	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25945.1	upstream_gene_variant ; 1219.0bp to feature; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25934.1	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25960.1	downstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25934.2	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25934.3	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N
vg0915584040	T -> A	LOC_Os09g25950.1	intron_variant ; MODIFIER	silent_mutation	Average:72.76; most accessible tissue: Callus, score: 89.217	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0915584040	NA	1.27E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.57E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	3.87E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	9.31E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	4.20E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.99E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	5.17E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.40E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	4.76E-32	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	4.15E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.41E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	2.04E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	2.68E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.01E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	7.25E-06	4.91E-25	mr1922_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	3.99E-24	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040	NA	1.11E-40	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251