\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915584040:

Variant ID: vg0915584040 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15584040
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCACTGCTGGATCCTTTATGTGTTCCATCTGAACACTGACCTTGATAAAATGTGGAATGACCCTGCTAGGTCCAAGCTAAAAGCAAAAGTATGATACGG[T/A]
GTTAATGCTTAATCCTTAGTTTGTACTTTTAATTCTTGATGAAAAATGATTCTTTGTCATGTTATATGTTTTGAGGATAAGGGGCTGAACCAACTAATCA

Reverse complement sequence

TGATTAGTTGGTTCAGCCCCTTATCCTCAAAACATATAACATGACAAAGAATCATTTTTCATCAAGAATTAAAAGTACAAACTAAGGATTAAGCATTAAC[A/T]
CCGTATCATACTTTTGCTTTTAGCTTGGACCTAGCAGGGTCATTCCACATTTTATCAAGGTCAGTGTTCAGATGGAACACATAAAGGATCCAGCAGTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.60% 0.11% 0.02% NA
All Indica  2759 97.50% 2.30% 0.14% 0.04% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 98.20% 1.60% 0.11% 0.00% NA
Indica Intermediate  786 95.90% 3.80% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915584040 T -> DEL N N silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25945.1 upstream_gene_variant ; 1219.0bp to feature; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25934.1 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25960.1 downstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25934.2 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25934.3 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N
vg0915584040 T -> A LOC_Os09g25950.1 intron_variant ; MODIFIER silent_mutation Average:72.76; most accessible tissue: Callus, score: 89.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915584040 NA 1.27E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.57E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 3.87E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 9.31E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 4.20E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.99E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 5.17E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.40E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 4.76E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 4.15E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.41E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 2.04E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 2.68E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.01E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 7.25E-06 4.91E-25 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 3.99E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915584040 NA 1.11E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251