| Variant ID: vg0915452929 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 15452929 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.02, others allele: 0.00, population size: 41. )
TTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATTCCTATATGGACTCTAGACTCGTCTTTCAATATTTTTTTAATTCTGAATTTTTATTATCT[G/A]
TAAATTATATTTCTATATAGAGTCTCTTCTTCCAATATTATTTATTTTTAATTCTAATATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAAC
GTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATATTAGAATTAAAAATAAATAATATTGGAAGAAGAGACTCTATATAGAAATATAATTTA[C/T]
AGATAATAAAAATTCAGAATTAAAAAAATATTGAAAGACGAGTCTAGAGTCCATATAGGAATATAATTTACAAATAACTAAAATTTGATATTAAAAATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 13.00% | 2.37% | 19.49% | NA |
| All Indica | 2759 | 43.50% | 22.10% | 3.26% | 31.13% | NA |
| All Japonica | 1512 | 95.40% | 0.10% | 1.32% | 3.17% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.40% | 31.90% | 7.23% | 37.48% | NA |
| Indica II | 465 | 63.00% | 13.80% | 3.44% | 19.78% | NA |
| Indica III | 913 | 43.70% | 23.80% | 1.20% | 31.33% | NA |
| Indica Intermediate | 786 | 46.90% | 17.70% | 2.54% | 32.82% | NA |
| Temperate Japonica | 767 | 92.60% | 0.00% | 2.61% | 4.82% | NA |
| Tropical Japonica | 504 | 97.80% | 0.20% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 4.40% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0915452929 | G -> DEL | N | N | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0915452929 | G -> A | LOC_Os09g25770.1 | upstream_gene_variant ; 2917.0bp to feature; MODIFIER | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0915452929 | G -> A | LOC_Os09g25770.2 | upstream_gene_variant ; 2917.0bp to feature; MODIFIER | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0915452929 | G -> A | LOC_Os09g25800.1 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0915452929 | G -> A | LOC_Os09g25784.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0915452929 | G -> A | LOC_Os09g25784.2 | intron_variant ; MODIFIER | silent_mutation | Average:13.352; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0915452929 | NA | 2.14E-07 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 2.55E-06 | mr1013 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 7.45E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 1.39E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 2.79E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 6.19E-09 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | 1.51E-06 | 1.51E-06 | mr1717 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 9.29E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 1.10E-07 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | 7.82E-06 | NA | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0915452929 | NA | 7.67E-08 | mr1013_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |