Variant ID: vg0915200017 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 15200017 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 109. )
GAAAGAAATTTCCATATAAGAACCCAATACGAGATTAATCAAAATTCAAAATAAAAAAAAATAAAATCCAAAATTAGAAAAGAAAATGAGAGTCCAAGTA[G/A]
GAATACAATTTAAAATTAGCTGAAATTAGAAATTAAAAATAAGGAATATTAAAAGAAGAGTCCATATAAGAACCAAATACGAGATTAATTAAAATTCAGA
TCTGAATTTTAATTAATCTCGTATTTGGTTCTTATATGGACTCTTCTTTTAATATTCCTTATTTTTAATTTCTAATTTCAGCTAATTTTAAATTGTATTC[C/T]
TACTTGGACTCTCATTTTCTTTTCTAATTTTGGATTTTATTTTTTTTTATTTTGAATTTTGATTAATCTCGTATTGGGTTCTTATATGGAAATTTCTTTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.90% | 32.40% | 0.59% | 0.15% | NA |
All Indica | 2759 | 48.60% | 50.20% | 0.94% | 0.25% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 42.40% | 57.50% | 0.17% | 0.00% | NA |
Indica II | 465 | 63.40% | 35.90% | 0.43% | 0.22% | NA |
Indica III | 913 | 39.80% | 57.80% | 1.86% | 0.55% | NA |
Indica Intermediate | 786 | 54.80% | 44.30% | 0.76% | 0.13% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0915200017 | G -> DEL | N | N | silent_mutation | Average:17.194; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0915200017 | G -> A | LOC_Os09g25370.1 | downstream_gene_variant ; 4116.0bp to feature; MODIFIER | silent_mutation | Average:17.194; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
vg0915200017 | G -> A | LOC_Os09g25360-LOC_Os09g25370 | intergenic_region ; MODIFIER | silent_mutation | Average:17.194; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0915200017 | NA | 8.80E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915200017 | NA | 4.23E-07 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915200017 | 1.23E-06 | NA | mr1010_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915200017 | 7.20E-06 | 3.57E-09 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0915200017 | NA | 6.25E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |