\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915042464:

Variant ID: vg0915042464 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 15042464
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTCTCCTCAAGCCACCGTGCCCTATGTATATCATGCTGATAGCTTGCAATGGCACTTCTCTCCTCCACCGTGTCATCCGAGCCTATGTGGATGCTG[C/A]
GGGCATGGTGCTGAGACCACATTGTACATTGCCTTGGGGCATCAGCAGTGCGCCACCTATTTTGCAAACCTTGGGGCTACCACATAGGACGAATACACAA

Reverse complement sequence

TTGTGTATTCGTCCTATGTGGTAGCCCCAAGGTTTGCAAAATAGGTGGCGCACTGCTGATGCCCCAAGGCAATGTACAATGTGGTCTCAGCACCATGCCC[G/T]
CAGCATCCACATAGGCTCGGATGACACGGTGGAGGAGAGAAGTGCCATTGCAAGCTATCAGCATGATATACATAGGGCACGGTGGCTTGAGGAGAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 21.80% 13.27% 11.49% NA
All Indica  2759 60.70% 0.40% 20.01% 18.81% NA
All Japonica  1512 39.90% 59.30% 0.66% 0.20% NA
Aus  269 72.90% 2.20% 18.22% 6.69% NA
Indica I  595 51.30% 0.20% 27.56% 21.01% NA
Indica II  465 62.80% 0.60% 21.94% 14.62% NA
Indica III  913 66.20% 0.10% 13.58% 20.15% NA
Indica Intermediate  786 60.40% 0.90% 20.61% 18.07% NA
Temperate Japonica  767 67.00% 32.20% 0.52% 0.26% NA
Tropical Japonica  504 4.80% 94.80% 0.20% 0.20% NA
Japonica Intermediate  241 27.00% 71.00% 2.07% 0.00% NA
VI/Aromatic  96 9.40% 87.50% 3.12% 0.00% NA
Intermediate  90 46.70% 35.60% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915042464 C -> DEL N N silent_mutation Average:88.643; most accessible tissue: Zhenshan97 panicle, score: 96.924 N N N N
vg0915042464 C -> A LOC_Os09g25120.1 upstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:88.643; most accessible tissue: Zhenshan97 panicle, score: 96.924 N N N N
vg0915042464 C -> A LOC_Os09g25120-LOC_Os09g25130 intergenic_region ; MODIFIER silent_mutation Average:88.643; most accessible tissue: Zhenshan97 panicle, score: 96.924 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0915042464 C A -0.01 -0.01 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915042464 NA 1.22E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 4.91E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 1.27E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 7.42E-06 1.72E-06 mr1271 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 4.03E-07 2.92E-11 mr1271 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 4.30E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 2.14E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 8.46E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 2.02E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 4.40E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 4.34E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 4.34E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 8.14E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 7.20E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915042464 NA 1.02E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251