Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914400278:

Variant ID: vg0914400278 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 14400278
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TCCAAGGTAGCAACTATCATGAACAAATTTCAATCGGTGCTAAACCCTAAGCTTTATTCACTTGTGTGTGTGGCGATTCTTGACTCTATGAGATGATCCA[T/C]
ATTCCAACGATTCAGAATATTTGGAAATATCATAATAATAAAGGTTTACAAAGATATTGATGAGCATGTCCATGCGACTATCAATGATGCATGTTTATTT

Reverse complement sequence

AAATAAACATGCATCATTGATAGTCGCATGGACATGCTCATCAATATCTTTGTAAACCTTTATTATTATGATATTTCCAAATATTCTGAATCGTTGGAAT[A/G]
TGGATCATCTCATAGAGTCAAGAATCGCCACACACACAAGTGAATAAAGCTTAGGGTTTAGCACCGATTGAAATTTGTTCATGATAGTTGCTACCTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.70%	0.25%	0.00%	NA
All Indica	2759	72.80%	27.00%	0.18%	0.00%	NA
All Japonica	1512	1.30%	98.50%	0.20%	0.00%	NA
Aus	269	84.40%	15.60%	0.00%	0.00%	NA
Indica I	595	68.90%	31.10%	0.00%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	68.50%	31.40%	0.11%	0.00%	NA
Indica Intermediate	786	69.60%	30.00%	0.38%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	94.60%	1.24%	0.00%	NA
VI/Aromatic	96	80.20%	18.80%	1.04%	0.00%	NA
Intermediate	90	36.70%	60.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0914400278	T -> C	LOC_Os09g24250.1	upstream_gene_variant ; 804.0bp to feature; MODIFIER	silent_mutation	Average:57.088; most accessible tissue: Callus, score: 75.518	N	N	N	N
vg0914400278	T -> C	LOC_Os09g24260.1	upstream_gene_variant ; 4253.0bp to feature; MODIFIER	silent_mutation	Average:57.088; most accessible tissue: Callus, score: 75.518	N	N	N	N
vg0914400278	T -> C	LOC_Os09g24250-LOC_Os09g24260	intergenic_region ; MODIFIER	silent_mutation	Average:57.088; most accessible tissue: Callus, score: 75.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0914400278	NA	4.28E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	3.42E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.33E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	4.22E-07	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	4.42E-09	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.28E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	4.91E-16	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	3.77E-06	1.16E-10	mr1454_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.02E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.18E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.31E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	7.63E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	4.71E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	3.75E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.52E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	7.37E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.01E-10	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278	NA	1.81E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251