\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914400278:

Variant ID: vg0914400278 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14400278
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAGGTAGCAACTATCATGAACAAATTTCAATCGGTGCTAAACCCTAAGCTTTATTCACTTGTGTGTGTGGCGATTCTTGACTCTATGAGATGATCCA[T/C]
ATTCCAACGATTCAGAATATTTGGAAATATCATAATAATAAAGGTTTACAAAGATATTGATGAGCATGTCCATGCGACTATCAATGATGCATGTTTATTT

Reverse complement sequence

AAATAAACATGCATCATTGATAGTCGCATGGACATGCTCATCAATATCTTTGTAAACCTTTATTATTATGATATTTCCAAATATTCTGAATCGTTGGAAT[A/G]
TGGATCATCTCATAGAGTCAAGAATCGCCACACACACAAGTGAATAAAGCTTAGGGTTTAGCACCGATTGAAATTTGTTCATGATAGTTGCTACCTTGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.70% 0.25% 0.00% NA
All Indica  2759 72.80% 27.00% 0.18% 0.00% NA
All Japonica  1512 1.30% 98.50% 0.20% 0.00% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 68.90% 31.10% 0.00% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 68.50% 31.40% 0.11% 0.00% NA
Indica Intermediate  786 69.60% 30.00% 0.38% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 94.60% 1.24% 0.00% NA
VI/Aromatic  96 80.20% 18.80% 1.04% 0.00% NA
Intermediate  90 36.70% 60.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914400278 T -> C LOC_Os09g24250.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:57.088; most accessible tissue: Callus, score: 75.518 N N N N
vg0914400278 T -> C LOC_Os09g24260.1 upstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:57.088; most accessible tissue: Callus, score: 75.518 N N N N
vg0914400278 T -> C LOC_Os09g24250-LOC_Os09g24260 intergenic_region ; MODIFIER silent_mutation Average:57.088; most accessible tissue: Callus, score: 75.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914400278 NA 4.28E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 3.42E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.33E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 4.22E-07 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 4.42E-09 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.28E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 4.91E-16 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 3.77E-06 1.16E-10 mr1454_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.02E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.18E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.31E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 7.63E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 4.71E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 3.75E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.52E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 7.37E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.01E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914400278 NA 1.81E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251