Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914372823:

Variant ID: vg0914372823 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 14372823
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCAAATGCTAAAAAGACGAAATTGAGGTCTTCCGGTAGCTCGAGAAGGTACTGGGCTAGACGACCTTGGTTCGAAGCCCCACCCCTTCTAATAATTAG[C/T]
ATTTGATATTAGCTCGACAAGGTAGTGGGACCTGGGTTCGAAGCCACCCCTTCTAATAATTAGTATTTGATATTAGCTACTTCCCTAATATTCGCGTTTT

Reverse complement sequence

AAAACGCGAATATTAGGGAAGTAGCTAATATCAAATACTAATTATTAGAAGGGGTGGCTTCGAACCCAGGTCCCACTACCTTGTCGAGCTAATATCAAAT[G/A]
CTAATTATTAGAAGGGGTGGGGCTTCGAACCAAGGTCGTCTAGCCCAGTACCTTCTCGAGCTACCGGAAGACCTCAATTTCGTCTTTTTAGCATTTGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.80%	15.50%	9.80%	53.94%	NA
All Indica	2759	1.20%	0.60%	9.03%	89.20%	NA
All Japonica	1512	54.60%	44.20%	0.66%	0.53%	NA
Aus	269	0.40%	6.70%	73.98%	18.96%	NA
Indica I	595	0.80%	0.00%	3.19%	95.97%	NA
Indica II	465	3.40%	0.20%	16.13%	80.22%	NA
Indica III	913	0.10%	0.40%	6.79%	92.66%	NA
Indica Intermediate	786	1.40%	1.40%	11.83%	85.37%	NA
Temperate Japonica	767	89.20%	10.30%	0.00%	0.52%	NA
Tropical Japonica	504	10.50%	87.30%	1.59%	0.60%	NA
Japonica Intermediate	241	36.50%	62.20%	0.83%	0.41%	NA
VI/Aromatic	96	80.20%	14.60%	1.04%	4.17%	NA
Intermediate	90	50.00%	17.80%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0914372823	C -> DEL	N	N	silent_mutation	Average:54.9; most accessible tissue: Callus, score: 89.531	N	N	N	N
vg0914372823	C -> T	LOC_Os09g24210.1	intron_variant ; MODIFIER	silent_mutation	Average:54.9; most accessible tissue: Callus, score: 89.531	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0914372823	NA	5.66E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	4.18E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	6.91E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	3.11E-13	mr1449_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	4.94E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	1.10E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	4.52E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	7.63E-17	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	1.29E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	5.00E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	2.36E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823	NA	2.31E-08	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251