\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0914372823:

Variant ID: vg0914372823 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 14372823
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCAAATGCTAAAAAGACGAAATTGAGGTCTTCCGGTAGCTCGAGAAGGTACTGGGCTAGACGACCTTGGTTCGAAGCCCCACCCCTTCTAATAATTAG[C/T]
ATTTGATATTAGCTCGACAAGGTAGTGGGACCTGGGTTCGAAGCCACCCCTTCTAATAATTAGTATTTGATATTAGCTACTTCCCTAATATTCGCGTTTT

Reverse complement sequence

AAAACGCGAATATTAGGGAAGTAGCTAATATCAAATACTAATTATTAGAAGGGGTGGCTTCGAACCCAGGTCCCACTACCTTGTCGAGCTAATATCAAAT[G/A]
CTAATTATTAGAAGGGGTGGGGCTTCGAACCAAGGTCGTCTAGCCCAGTACCTTCTCGAGCTACCGGAAGACCTCAATTTCGTCTTTTTAGCATTTGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.80% 15.50% 9.80% 53.94% NA
All Indica  2759 1.20% 0.60% 9.03% 89.20% NA
All Japonica  1512 54.60% 44.20% 0.66% 0.53% NA
Aus  269 0.40% 6.70% 73.98% 18.96% NA
Indica I  595 0.80% 0.00% 3.19% 95.97% NA
Indica II  465 3.40% 0.20% 16.13% 80.22% NA
Indica III  913 0.10% 0.40% 6.79% 92.66% NA
Indica Intermediate  786 1.40% 1.40% 11.83% 85.37% NA
Temperate Japonica  767 89.20% 10.30% 0.00% 0.52% NA
Tropical Japonica  504 10.50% 87.30% 1.59% 0.60% NA
Japonica Intermediate  241 36.50% 62.20% 0.83% 0.41% NA
VI/Aromatic  96 80.20% 14.60% 1.04% 4.17% NA
Intermediate  90 50.00% 17.80% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0914372823 C -> DEL N N silent_mutation Average:54.9; most accessible tissue: Callus, score: 89.531 N N N N
vg0914372823 C -> T LOC_Os09g24210.1 intron_variant ; MODIFIER silent_mutation Average:54.9; most accessible tissue: Callus, score: 89.531 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0914372823 NA 5.66E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 4.18E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 6.91E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 3.11E-13 mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 4.94E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 1.10E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 4.52E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 7.63E-17 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 1.29E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 5.00E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 2.36E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914372823 NA 2.31E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251