Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0914025711:

Variant ID: vg0914025711 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 14025711
Reference Allele: G	Alternative Allele: A,GA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTATGGAGGTGTGGTTATGGAGTTTAGATCCCCTGGCAAAATTTTTCACCCTGTCATATCGAATGTTTGGACATATGTATAGAGTATTAAATATAAAC[G/A,GA]
AAAAAAACAACTAATTACACAGATTGCATATAAATTACGAGGTGCCATCCTCATCTCCACTCATACAACGGTGCCATGGACATGAGACCACAAGAAGATC

Reverse complement sequence

GATCTTCTTGTGGTCTCATGTCCATGGCACCGTTGTATGAGTGGAGATGAGGATGGCACCTCGTAATTTATATGCAATCTGTGTAATTAGTTGTTTTTTT[C/T,TC]
GTTTATATTTAATACTCTATACATATGTCCAAACATTCGATATGACAGGGTGAAAAATTTTGCCAGGGGATCTAAACTCCATAACCACACCTCCATACCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	17.10%	0.08%	0.00%	GA: 7.68%
All Indica	2759	91.50%	1.30%	0.04%	0.00%	GA: 7.10%
All Japonica	1512	50.20%	49.70%	0.07%	0.00%	GA: 0.07%
Aus	269	37.90%	0.70%	0.74%	0.00%	GA: 60.59%
Indica I	595	94.50%	0.30%	0.00%	0.00%	GA: 5.21%
Indica II	465	95.30%	3.00%	0.00%	0.00%	GA: 1.72%
Indica III	913	88.60%	1.30%	0.11%	0.00%	GA: 9.97%
Indica Intermediate	786	90.50%	1.10%	0.00%	0.00%	GA: 8.40%
Temperate Japonica	767	12.50%	87.40%	0.13%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	73.40%	26.10%	0.00%	0.00%	GA: 0.41%
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	20.00%	0.00%	0.00%	GA: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0914025711	G -> GA	LOC_Os09g23595.1	upstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N
vg0914025711	G -> GA	LOC_Os09g23620.1	upstream_gene_variant ; 3720.0bp to feature; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N
vg0914025711	G -> GA	LOC_Os09g23610.1	intron_variant ; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N
vg0914025711	G -> A	LOC_Os09g23595.1	upstream_gene_variant ; 3889.0bp to feature; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N
vg0914025711	G -> A	LOC_Os09g23620.1	upstream_gene_variant ; 3721.0bp to feature; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N
vg0914025711	G -> A	LOC_Os09g23610.1	intron_variant ; MODIFIER	silent_mutation	Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0914025711	NA	3.99E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	2.64E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	2.23E-14	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	1.48E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	3.37E-08	mr1181_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	9.28E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	1.57E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	2.75E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0914025711	NA	1.39E-11	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251