\
| Variant ID: vg0914025711 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 14025711 |
| Reference Allele: G | Alternative Allele: A,GA |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 241. )
GGGTATGGAGGTGTGGTTATGGAGTTTAGATCCCCTGGCAAAATTTTTCACCCTGTCATATCGAATGTTTGGACATATGTATAGAGTATTAAATATAAAC[G/A,GA]
AAAAAAACAACTAATTACACAGATTGCATATAAATTACGAGGTGCCATCCTCATCTCCACTCATACAACGGTGCCATGGACATGAGACCACAAGAAGATC
GATCTTCTTGTGGTCTCATGTCCATGGCACCGTTGTATGAGTGGAGATGAGGATGGCACCTCGTAATTTATATGCAATCTGTGTAATTAGTTGTTTTTTT[C/T,TC]
GTTTATATTTAATACTCTATACATATGTCCAAACATTCGATATGACAGGGTGAAAAATTTTGCCAGGGGATCTAAACTCCATAACCACACCTCCATACCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 17.10% | 0.08% | 0.00% | GA: 7.68% |
| All Indica | 2759 | 91.50% | 1.30% | 0.04% | 0.00% | GA: 7.10% |
| All Japonica | 1512 | 50.20% | 49.70% | 0.07% | 0.00% | GA: 0.07% |
| Aus | 269 | 37.90% | 0.70% | 0.74% | 0.00% | GA: 60.59% |
| Indica I | 595 | 94.50% | 0.30% | 0.00% | 0.00% | GA: 5.21% |
| Indica II | 465 | 95.30% | 3.00% | 0.00% | 0.00% | GA: 1.72% |
| Indica III | 913 | 88.60% | 1.30% | 0.11% | 0.00% | GA: 9.97% |
| Indica Intermediate | 786 | 90.50% | 1.10% | 0.00% | 0.00% | GA: 8.40% |
| Temperate Japonica | 767 | 12.50% | 87.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.00% | 0.00% | GA: 0.41% |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 0.00% | 0.00% | GA: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0914025711 | G -> GA | LOC_Os09g23595.1 | upstream_gene_variant ; 3890.0bp to feature; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0914025711 | G -> GA | LOC_Os09g23620.1 | upstream_gene_variant ; 3720.0bp to feature; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0914025711 | G -> GA | LOC_Os09g23610.1 | intron_variant ; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0914025711 | G -> A | LOC_Os09g23595.1 | upstream_gene_variant ; 3889.0bp to feature; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0914025711 | G -> A | LOC_Os09g23620.1 | upstream_gene_variant ; 3721.0bp to feature; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0914025711 | G -> A | LOC_Os09g23610.1 | intron_variant ; MODIFIER | silent_mutation | Average:69.071; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0914025711 | NA | 3.99E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 2.64E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 2.23E-14 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 1.48E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 3.37E-08 | mr1181_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 9.28E-09 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 1.57E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 2.75E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0914025711 | NA | 1.39E-11 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |