\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913716234:

Variant ID: vg0913716234 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13716234
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTATATACGTATAAATATATACATATAAATATAGAACTTATACAACATGTGGGAGGTAGGGGGATGGGCTCGAAGGAAAGTGTTGATCCGATCATGGG[C/T]
GCACCATGACACGCGATCAGTCGCACATTAGCGACCCCCTCTCGAGCTTCCCTAATATATTGCACACTTTGTATATAAGACTATTAATAGTTCAACATAT

Reverse complement sequence

ATATGTTGAACTATTAATAGTCTTATATACAAAGTGTGCAATATATTAGGGAAGCTCGAGAGGGGGTCGCTAATGTGCGACTGATCGCGTGTCATGGTGC[G/A]
CCCATGATCGGATCAACACTTTCCTTCGAGCCCATCCCCCTACCTCCCACATGTTGTATAAGTTCTATATTTATATGTATATATTTATACGTATATACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 42.40% 0.08% 0.28% NA
All Indica  2759 82.20% 17.40% 0.11% 0.22% NA
All Japonica  1512 7.70% 91.90% 0.07% 0.33% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 92.30% 7.10% 0.17% 0.50% NA
Indica II  465 87.70% 11.80% 0.00% 0.43% NA
Indica III  913 71.10% 28.90% 0.00% 0.00% NA
Indica Intermediate  786 84.40% 15.30% 0.25% 0.13% NA
Temperate Japonica  767 2.30% 97.30% 0.00% 0.39% NA
Tropical Japonica  504 17.30% 82.10% 0.20% 0.40% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 36.70% 61.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913716234 C -> DEL N N silent_mutation Average:79.623; most accessible tissue: Callus, score: 89.676 N N N N
vg0913716234 C -> T LOC_Os09g23170.1 upstream_gene_variant ; 3074.0bp to feature; MODIFIER silent_mutation Average:79.623; most accessible tissue: Callus, score: 89.676 N N N N
vg0913716234 C -> T LOC_Os09g23160.1 downstream_gene_variant ; 4723.0bp to feature; MODIFIER silent_mutation Average:79.623; most accessible tissue: Callus, score: 89.676 N N N N
vg0913716234 C -> T LOC_Os09g23160.2 downstream_gene_variant ; 4723.0bp to feature; MODIFIER silent_mutation Average:79.623; most accessible tissue: Callus, score: 89.676 N N N N
vg0913716234 C -> T LOC_Os09g23170-LOC_Os09g23180 intergenic_region ; MODIFIER silent_mutation Average:79.623; most accessible tissue: Callus, score: 89.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913716234 NA 2.61E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 7.64E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.95E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.98E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 7.39E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 1.01E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.90E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 6.74E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.26E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.13E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 8.82E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.32E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 1.39E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.26E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 3.95E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.01E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.36E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 9.69E-06 1.96E-08 mr1508 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.35E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.62E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 1.95E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 1.86E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 3.39E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 3.36E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 4.77E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.89E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.89E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 4.65E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 7.01E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.25E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.55E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 4.25E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 5.30E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 1.05E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 7.10E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 8.67E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 7.43E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234 NA 2.06E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251