Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913716234:

Variant ID: vg0913716234 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 13716234
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTATATACGTATAAATATATACATATAAATATAGAACTTATACAACATGTGGGAGGTAGGGGGATGGGCTCGAAGGAAAGTGTTGATCCGATCATGGG[C/T]
GCACCATGACACGCGATCAGTCGCACATTAGCGACCCCCTCTCGAGCTTCCCTAATATATTGCACACTTTGTATATAAGACTATTAATAGTTCAACATAT

Reverse complement sequence

ATATGTTGAACTATTAATAGTCTTATATACAAAGTGTGCAATATATTAGGGAAGCTCGAGAGGGGGTCGCTAATGTGCGACTGATCGCGTGTCATGGTGC[G/A]
CCCATGATCGGATCAACACTTTCCTTCGAGCCCATCCCCCTACCTCCCACATGTTGTATAAGTTCTATATTTATATGTATATATTTATACGTATATACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.30%	42.40%	0.08%	0.28%	NA
All Indica	2759	82.20%	17.40%	0.11%	0.22%	NA
All Japonica	1512	7.70%	91.90%	0.07%	0.33%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	92.30%	7.10%	0.17%	0.50%	NA
Indica II	465	87.70%	11.80%	0.00%	0.43%	NA
Indica III	913	71.10%	28.90%	0.00%	0.00%	NA
Indica Intermediate	786	84.40%	15.30%	0.25%	0.13%	NA
Temperate Japonica	767	2.30%	97.30%	0.00%	0.39%	NA
Tropical Japonica	504	17.30%	82.10%	0.20%	0.40%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	36.70%	61.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0913716234	C -> DEL	N	N	silent_mutation	Average:79.623; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg0913716234	C -> T	LOC_Os09g23170.1	upstream_gene_variant ; 3074.0bp to feature; MODIFIER	silent_mutation	Average:79.623; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg0913716234	C -> T	LOC_Os09g23160.1	downstream_gene_variant ; 4723.0bp to feature; MODIFIER	silent_mutation	Average:79.623; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg0913716234	C -> T	LOC_Os09g23160.2	downstream_gene_variant ; 4723.0bp to feature; MODIFIER	silent_mutation	Average:79.623; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg0913716234	C -> T	LOC_Os09g23170-LOC_Os09g23180	intergenic_region ; MODIFIER	silent_mutation	Average:79.623; most accessible tissue: Callus, score: 89.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0913716234	NA	2.61E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	7.64E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.95E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.98E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	7.39E-10	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	1.01E-17	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.90E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	6.74E-08	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.26E-15	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.13E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	8.82E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.32E-08	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	1.39E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.26E-15	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	3.95E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.01E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.36E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	9.69E-06	1.96E-08	mr1508	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.35E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.62E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	1.95E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	1.86E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	3.39E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	3.36E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	4.77E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.89E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.89E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	4.65E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	7.01E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.25E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.55E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	4.25E-19	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	5.30E-12	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	1.05E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	7.10E-08	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	8.67E-15	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	7.43E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913716234	NA	2.06E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251