\
| Variant ID: vg0913505389 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13505389 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTGAGTGAATAACACTCTAAAAAGTTCACAAATGAACACATTTGACAGGCACCCGAGTAGAAAACTCTAAAGATAACCCATCAAATATTATAAAAATTA[T/C]
GGTAATTAATAAGTCTAATAGCCTAGGCTATGACTCTTCACCATAATTAAAATAGGCATATAACACGCCAAGAGAATGACCATTGTAAAAACAAGTCATC
GATGACTTGTTTTTACAATGGTCATTCTCTTGGCGTGTTATATGCCTATTTTAATTATGGTGAAGAGTCATAGCCTAGGCTATTAGACTTATTAATTACC[A/G]
TAATTTTTATAATATTTGATGGGTTATCTTTAGAGTTTTCTACTCGGGTGCCTGTCAAATGTGTTCATTTGTGAACTTTTTAGAGTGTTATTCACTCAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 5.90% | 4.27% | 17.12% | NA |
| All Indica | 2759 | 65.20% | 4.70% | 5.73% | 24.39% | NA |
| All Japonica | 1512 | 92.50% | 0.30% | 0.53% | 6.68% | NA |
| Aus | 269 | 58.70% | 26.00% | 9.29% | 5.95% | NA |
| Indica I | 595 | 57.00% | 6.10% | 9.58% | 27.39% | NA |
| Indica II | 465 | 84.10% | 2.40% | 5.59% | 7.96% | NA |
| Indica III | 913 | 58.50% | 5.50% | 5.04% | 31.00% | NA |
| Indica Intermediate | 786 | 68.10% | 4.10% | 3.69% | 24.17% | NA |
| Temperate Japonica | 767 | 96.10% | 0.10% | 0.39% | 3.39% | NA |
| Tropical Japonica | 504 | 86.10% | 0.20% | 0.60% | 13.10% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.80% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 15.60% | 67.70% | 9.38% | 7.29% | NA |
| Intermediate | 90 | 72.20% | 12.20% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913505389 | T -> DEL | N | N | silent_mutation | Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0913505389 | T -> C | LOC_Os09g22350.1 | upstream_gene_variant ; 609.0bp to feature; MODIFIER | silent_mutation | Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0913505389 | T -> C | LOC_Os09g22360.1 | downstream_gene_variant ; 3851.0bp to feature; MODIFIER | silent_mutation | Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0913505389 | T -> C | LOC_Os09g22340-LOC_Os09g22350 | intergenic_region ; MODIFIER | silent_mutation | Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913505389 | NA | 2.55E-07 | mr1027_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913505389 | 3.34E-06 | NA | mr1423_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913505389 | NA | 3.68E-06 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913505389 | NA | 8.83E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913505389 | NA | 5.45E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |