\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0913505389:

Variant ID: vg0913505389 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 13505389
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGAGTGAATAACACTCTAAAAAGTTCACAAATGAACACATTTGACAGGCACCCGAGTAGAAAACTCTAAAGATAACCCATCAAATATTATAAAAATTA[T/C]
GGTAATTAATAAGTCTAATAGCCTAGGCTATGACTCTTCACCATAATTAAAATAGGCATATAACACGCCAAGAGAATGACCATTGTAAAAACAAGTCATC

Reverse complement sequence

GATGACTTGTTTTTACAATGGTCATTCTCTTGGCGTGTTATATGCCTATTTTAATTATGGTGAAGAGTCATAGCCTAGGCTATTAGACTTATTAATTACC[A/G]
TAATTTTTATAATATTTGATGGGTTATCTTTAGAGTTTTCTACTCGGGTGCCTGTCAAATGTGTTCATTTGTGAACTTTTTAGAGTGTTATTCACTCAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 5.90% 4.27% 17.12% NA
All Indica  2759 65.20% 4.70% 5.73% 24.39% NA
All Japonica  1512 92.50% 0.30% 0.53% 6.68% NA
Aus  269 58.70% 26.00% 9.29% 5.95% NA
Indica I  595 57.00% 6.10% 9.58% 27.39% NA
Indica II  465 84.10% 2.40% 5.59% 7.96% NA
Indica III  913 58.50% 5.50% 5.04% 31.00% NA
Indica Intermediate  786 68.10% 4.10% 3.69% 24.17% NA
Temperate Japonica  767 96.10% 0.10% 0.39% 3.39% NA
Tropical Japonica  504 86.10% 0.20% 0.60% 13.10% NA
Japonica Intermediate  241 94.60% 0.80% 0.83% 3.73% NA
VI/Aromatic  96 15.60% 67.70% 9.38% 7.29% NA
Intermediate  90 72.20% 12.20% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0913505389 T -> DEL N N silent_mutation Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0913505389 T -> C LOC_Os09g22350.1 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0913505389 T -> C LOC_Os09g22360.1 downstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0913505389 T -> C LOC_Os09g22340-LOC_Os09g22350 intergenic_region ; MODIFIER silent_mutation Average:12.68; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0913505389 NA 2.55E-07 mr1027_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913505389 3.34E-06 NA mr1423_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913505389 NA 3.68E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913505389 NA 8.83E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0913505389 NA 5.45E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251