\
| Variant ID: vg0913504451 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 13504451 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGTTTTCAACTCGATCCAACGGTTGGTTTAAGAGAAATCGTGTTTTTACCGAAGCGCTGTCGTGCTGTTTTCAGGCTGACGGTCAGACCGCGAGAGGAC[C/A,T]
TGCGGTTAGACCGGTTAGAGTTCGGTCAGACCGATCCTAGTAGGTCGGATAGACCGCCAAACGTGTGTTCCATTGGCTTTTGAGGTTTGTCGAAACAAGA
TCTTGTTTCGACAAACCTCAAAAGCCAATGGAACACACGTTTGGCGGTCTATCCGACCTACTAGGATCGGTCTGACCGAACTCTAACCGGTCTAACCGCA[G/T,A]
GTCCTCTCGCGGTCTGACCGTCAGCCTGAAAACAGCACGACAGCGCTTCGGTAAAAACACGATTTCTCTTAAACCAACCGTTGGATCGAGTTGAAAACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 38.20% | 4.17% | 2.92% | T: 0.02% |
| All Indica | 2759 | 82.30% | 12.30% | 3.23% | 2.10% | T: 0.04% |
| All Japonica | 1512 | 3.00% | 89.20% | 2.98% | 4.89% | NA |
| Aus | 269 | 58.40% | 24.90% | 15.99% | 0.74% | NA |
| Indica I | 595 | 80.20% | 16.80% | 2.86% | 0.17% | NA |
| Indica II | 465 | 76.30% | 18.70% | 4.30% | 0.65% | NA |
| Indica III | 913 | 89.90% | 4.60% | 1.75% | 3.61% | T: 0.11% |
| Indica Intermediate | 786 | 78.80% | 14.00% | 4.58% | 2.67% | NA |
| Temperate Japonica | 767 | 2.90% | 92.00% | 1.83% | 3.26% | NA |
| Tropical Japonica | 504 | 3.40% | 82.70% | 5.16% | 8.73% | NA |
| Japonica Intermediate | 241 | 2.50% | 93.40% | 2.07% | 2.07% | NA |
| VI/Aromatic | 96 | 80.20% | 4.20% | 14.58% | 1.04% | NA |
| Intermediate | 90 | 38.90% | 51.10% | 6.67% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0913504451 | C -> DEL | N | N | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> T | LOC_Os09g22350.1 | upstream_gene_variant ; 1547.0bp to feature; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> T | LOC_Os09g22360.1 | downstream_gene_variant ; 4789.0bp to feature; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> T | LOC_Os09g22340-LOC_Os09g22350 | intergenic_region ; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> A | LOC_Os09g22350.1 | upstream_gene_variant ; 1547.0bp to feature; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> A | LOC_Os09g22360.1 | downstream_gene_variant ; 4789.0bp to feature; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0913504451 | C -> A | LOC_Os09g22340-LOC_Os09g22350 | intergenic_region ; MODIFIER | silent_mutation | Average:37.459; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0913504451 | 1.69E-06 | 4.80E-07 | mr1857 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0913504451 | 4.61E-06 | 1.82E-07 | mr1857 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |