Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0912965190:

Variant ID: vg0912965190 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12965190
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCTTATTACTACCAGTAGAGATCATTGTAAGAAAACTTCTCGGTCAACGGTTACTGTATTCATACTAAATTGTCGCATTAATATTGAAATATTATAC[G/A]
AGAGGAGATGTACTACGTATATGGATCAATTGTATTGAGCCTCGAATACCGATGTACATATACGGTGTATATATATAGAGTACAAGAGATAAGGAAGAAA

Reverse complement sequence

TTTCTTCCTTATCTCTTGTACTCTATATATATACACCGTATATGTACATCGGTATTCGAGGCTCAATACAATTGATCCATATACGTAGTACATCTCCTCT[C/T]
GTATAATATTTCAATATTAATGCGACAATTTAGTATGAATACAGTAACCGTTGACCGAGAAGTTTTCTTACAATGATCTCTACTGGTAGTAATAAGATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	5.40%	0.95%	0.00%	NA
All Indica	2759	91.60%	8.40%	0.07%	0.00%	NA
All Japonica	1512	95.80%	1.60%	2.65%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	89.50%	10.50%	0.00%	0.00%	NA
Indica III	913	88.60%	11.30%	0.11%	0.00%	NA
Indica Intermediate	786	89.80%	10.10%	0.13%	0.00%	NA
Temperate Japonica	767	92.60%	3.10%	4.30%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	97.90%	0.00%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912965190	G -> A	LOC_Os09g21430.1	upstream_gene_variant ; 3411.0bp to feature; MODIFIER	silent_mutation	Average:62.401; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0912965190	G -> A	LOC_Os09g21440.1	downstream_gene_variant ; 306.0bp to feature; MODIFIER	silent_mutation	Average:62.401; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0912965190	G -> A	LOC_Os09g21450.1	downstream_gene_variant ; 4288.0bp to feature; MODIFIER	silent_mutation	Average:62.401; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0912965190	G -> A	LOC_Os09g21430-LOC_Os09g21440	intergenic_region ; MODIFIER	silent_mutation	Average:62.401; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912965190	NA	6.05E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912965190	NA	6.81E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912965190	NA	2.02E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912965190	NA	5.08E-09	mr1958	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251