\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912631853:

Variant ID: vg0912631853 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12631853
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTAACTTTCTATTTACTGATGCGATCATCTATGAAGGTGTTTATAGTGAACTAGGCATTAACATCATACTCCATGTTGGCCTTGAGGGGCATGACTA[C/T]
GTTGACTCGCGAGCTATGTTTAAAGGCAGTGGAGAAATAAAGCCTCGGCGACTACAGTCGGCTTTATTACAGTGTTATCTTATTAACCATTAGGAACAAT

Reverse complement sequence

ATTGTTCCTAATGGTTAATAAGATAACACTGTAATAAAGCCGACTGTAGTCGCCGAGGCTTTATTTCTCCACTGCCTTTAAACATAGCTCGCGAGTCAAC[G/A]
TAGTCATGCCCCTCAAGGCCAACATGGAGTATGATGTTAATGCCTAGTTCACTATAAACACCTTCATAGATGATCGCATCAGTAAATAGAAAGTTAAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 0.40% 17.90% 19.70% NA
All Indica  2759 43.00% 0.50% 26.10% 30.34% NA
All Japonica  1512 93.10% 0.10% 3.70% 3.11% NA
Aus  269 63.90% 0.40% 21.19% 14.50% NA
Indica I  595 10.80% 0.50% 37.65% 51.09% NA
Indica II  465 57.20% 0.00% 9.89% 32.90% NA
Indica III  913 55.60% 0.80% 30.01% 13.58% NA
Indica Intermediate  786 44.40% 0.60% 22.39% 32.57% NA
Temperate Japonica  767 98.00% 0.00% 0.65% 1.30% NA
Tropical Japonica  504 83.90% 0.20% 9.52% 6.35% NA
Japonica Intermediate  241 96.30% 0.40% 1.24% 2.07% NA
VI/Aromatic  96 91.70% 1.00% 5.21% 2.08% NA
Intermediate  90 84.40% 0.00% 8.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912631853 C -> DEL N N silent_mutation Average:14.871; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0912631853 C -> T LOC_Os09g20970.1 downstream_gene_variant ; 2199.0bp to feature; MODIFIER silent_mutation Average:14.871; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0912631853 C -> T LOC_Os09g20970-LOC_Os09g20980 intergenic_region ; MODIFIER silent_mutation Average:14.871; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912631853 NA 7.93E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 6.53E-06 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 2.66E-07 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 1.11E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 6.36E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 4.18E-07 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 3.13E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 2.11E-07 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 7.81E-07 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 3.74E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 2.39E-08 mr1780 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 4.76E-06 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 2.94E-06 8.98E-08 mr1792 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 1.64E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 9.67E-06 9.67E-06 mr1456_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912631853 NA 2.05E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251