\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912288601:

Variant ID: vg0912288601 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12288601
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTCGGATGAAGAAATGACCAAAATAAAAGTTATAGATCTTGACGAGTTATACAACTTTGTTCTTGATGACTTTTTCAGTTGAAATCATTTAATATTT[G/C]
AAAATGTTGTTTGAAGTTATCATATTTTAAAATTCAAATTCAAATTGTTTAAACAAAGTCATATAGAAAAATGACCCAAACAAAAGTTGTTGATCTTGAT

Reverse complement sequence

ATCAAGATCAACAACTTTTGTTTGGGTCATTTTTCTATATGACTTTGTTTAAACAATTTGAATTTGAATTTTAAAATATGATAACTTCAAACAACATTTT[C/G]
AAATATTAAATGATTTCAACTGAAAAAGTCATCAAGAACAAAGTTGTATAACTCGTCAAGATCTATAACTTTTATTTTGGTCATTTCTTCATCCGACAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 34.10% 0.76% 0.00% NA
All Indica  2759 43.30% 55.40% 1.23% 0.00% NA
All Japonica  1512 95.70% 4.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 11.10% 86.60% 2.35% 0.00% NA
Indica II  465 66.00% 33.30% 0.65% 0.00% NA
Indica III  913 56.00% 43.80% 0.22% 0.00% NA
Indica Intermediate  786 39.70% 58.40% 1.91% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912288601 G -> C LOC_Os09g20420.1 downstream_gene_variant ; 3166.0bp to feature; MODIFIER silent_mutation Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 N N N N
vg0912288601 G -> C LOC_Os09g20430.1 downstream_gene_variant ; 991.0bp to feature; MODIFIER silent_mutation Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 N N N N
vg0912288601 G -> C LOC_Os09g20420-LOC_Os09g20430 intergenic_region ; MODIFIER silent_mutation Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912288601 NA 7.52E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 6.86E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 1.37E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 9.69E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 4.15E-08 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 3.68E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 3.23E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 1.71E-06 3.33E-06 mr1803_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912288601 NA 1.74E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251