| Variant ID: vg0912288601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12288601 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.04, others allele: 0.00, population size: 105. )
TTTGTCGGATGAAGAAATGACCAAAATAAAAGTTATAGATCTTGACGAGTTATACAACTTTGTTCTTGATGACTTTTTCAGTTGAAATCATTTAATATTT[G/C]
AAAATGTTGTTTGAAGTTATCATATTTTAAAATTCAAATTCAAATTGTTTAAACAAAGTCATATAGAAAAATGACCCAAACAAAAGTTGTTGATCTTGAT
ATCAAGATCAACAACTTTTGTTTGGGTCATTTTTCTATATGACTTTGTTTAAACAATTTGAATTTGAATTTTAAAATATGATAACTTCAAACAACATTTT[C/G]
AAATATTAAATGATTTCAACTGAAAAAGTCATCAAGAACAAAGTTGTATAACTCGTCAAGATCTATAACTTTTATTTTGGTCATTTCTTCATCCGACAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 34.10% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 43.30% | 55.40% | 1.23% | 0.00% | NA |
| All Japonica | 1512 | 95.70% | 4.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 11.10% | 86.60% | 2.35% | 0.00% | NA |
| Indica II | 465 | 66.00% | 33.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 56.00% | 43.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 39.70% | 58.40% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912288601 | G -> C | LOC_Os09g20420.1 | downstream_gene_variant ; 3166.0bp to feature; MODIFIER | silent_mutation | Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
| vg0912288601 | G -> C | LOC_Os09g20430.1 | downstream_gene_variant ; 991.0bp to feature; MODIFIER | silent_mutation | Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
| vg0912288601 | G -> C | LOC_Os09g20420-LOC_Os09g20430 | intergenic_region ; MODIFIER | silent_mutation | Average:35.215; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912288601 | NA | 7.52E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 6.86E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 1.37E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 9.69E-06 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 4.15E-08 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 3.68E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 3.23E-06 | mr1780_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | 1.71E-06 | 3.33E-06 | mr1803_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912288601 | NA | 1.74E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |