\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912250614:

Variant ID: vg0912250614 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12250614
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGATTATGTACTATTTGCCCATTTATGTAAATAGAAATGATAGAGGCCTTGACCTCTCTTTTTGGAAGAAGATAACATGACTTGAGAAGCATACTAA[C/T]
ATAGACTATCTTCATGATAGTGTGAGTGTGATGTGACGTCTCAATGCCATTTGAAATCTGTAGGAAGCCAACGACATAGTCTATTTGTACCACCATAAAC

Reverse complement sequence

GTTTATGGTGGTACAAATAGACTATGTCGTTGGCTTCCTACAGATTTCAAATGGCATTGAGACGTCACATCACACTCACACTATCATGAAGATAGTCTAT[G/A]
TTAGTATGCTTCTCAAGTCATGTTATCTTCTTCCAAAAAGAGAGGTCAAGGCCTCTATCATTTCTATTTACATAAATGGGCAAATAGTACATAATCCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 20.60% 1.04% 5.31% NA
All Indica  2759 87.20% 3.40% 0.62% 8.84% NA
All Japonica  1512 62.40% 35.90% 1.52% 0.13% NA
Aus  269 5.90% 93.30% 0.74% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 59.10% 7.10% 2.58% 31.18% NA
Indica III  913 94.30% 2.80% 0.11% 2.74% NA
Indica Intermediate  786 85.90% 4.20% 0.51% 9.41% NA
Temperate Japonica  767 95.20% 3.80% 0.78% 0.26% NA
Tropical Japonica  504 19.40% 78.40% 2.18% 0.00% NA
Japonica Intermediate  241 48.10% 49.40% 2.49% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 57.80% 28.90% 7.78% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912250614 C -> DEL N N silent_mutation Average:68.047; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0912250614 C -> T LOC_Os09g20390.1 upstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:68.047; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0912250614 C -> T LOC_Os09g20390.3 upstream_gene_variant ; 1277.0bp to feature; MODIFIER silent_mutation Average:68.047; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0912250614 C -> T LOC_Os09g20390.2 upstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:68.047; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0912250614 C -> T LOC_Os09g20380-LOC_Os09g20390 intergenic_region ; MODIFIER silent_mutation Average:68.047; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0912250614 C T 0.21 0.02 0.01 0.0 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912250614 NA 6.97E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 8.88E-09 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 3.66E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 1.09E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 9.55E-12 mr1552 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 1.14E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 7.56E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 2.87E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 8.05E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 1.32E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 1.45E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 8.61E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 9.27E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 8.56E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 2.02E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 6.02E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 5.41E-12 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 1.41E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912250614 NA 4.99E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251