\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912195782:

Variant ID: vg0912195782 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12195782
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.05, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGGGATTATTGTGGTTTTTGGCCGACCAGACAAAGATGGTTTCTCAAGTAGTGCTAGCTCTAATGCTCGATTTCTTTCTGCATCTTCTCCTATACCTC[G/C,A]
CTAGCCGCTACGAATAATCGGGCAGTCAGCCTCGTCGTGAGATGGAATCGAGTTTTGAAACAGATGGTTGCAGAAAAGTTGAGATGAAAGTTCATTTGTT

Reverse complement sequence

AACAAATGAACTTTCATCTCAACTTTTCTGCAACCATCTGTTTCAAAACTCGATTCCATCTCACGACGAGGCTGACTGCCCGATTATTCGTAGCGGCTAG[C/G,T]
GAGGTATAGGAGAAGATGCAGAAAGAAATCGAGCATTAGAGCTAGCACTACTTGAGAAACCATCTTTGTCTGGTCGGCCAAAAACCACAATAATCCCGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 45.60% 0.28% 0.55% A: 0.02%
All Indica  2759 27.30% 71.50% 0.40% 0.83% NA
All Japonica  1512 98.90% 0.80% 0.13% 0.13% NA
Aus  269 48.70% 51.30% 0.00% 0.00% NA
Indica I  595 6.40% 92.30% 1.01% 0.34% NA
Indica II  465 53.80% 45.20% 0.00% 1.08% NA
Indica III  913 26.90% 72.30% 0.00% 0.77% NA
Indica Intermediate  786 27.90% 70.40% 0.64% 1.15% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.41% 0.41% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 0.00% 1.11% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912195782 G -> DEL N N silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> C LOC_Os09g20330.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> C LOC_Os09g20320.1 downstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> C LOC_Os09g20320-LOC_Os09g20330 intergenic_region ; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> A LOC_Os09g20330.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> A LOC_Os09g20320.1 downstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N
vg0912195782 G -> A LOC_Os09g20320-LOC_Os09g20330 intergenic_region ; MODIFIER silent_mutation Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912195782 NA 3.57E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 2.74E-06 2.61E-11 mr1425 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 4.36E-06 2.04E-10 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 7.40E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 9.45E-06 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 1.24E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 4.98E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 4.91E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 1.06E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 2.20E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 3.48E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912195782 NA 3.48E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251