| Variant ID: vg0912195782 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12195782 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.05, others allele: 0.00, population size: 232. )
ACCGGGATTATTGTGGTTTTTGGCCGACCAGACAAAGATGGTTTCTCAAGTAGTGCTAGCTCTAATGCTCGATTTCTTTCTGCATCTTCTCCTATACCTC[G/C,A]
CTAGCCGCTACGAATAATCGGGCAGTCAGCCTCGTCGTGAGATGGAATCGAGTTTTGAAACAGATGGTTGCAGAAAAGTTGAGATGAAAGTTCATTTGTT
AACAAATGAACTTTCATCTCAACTTTTCTGCAACCATCTGTTTCAAAACTCGATTCCATCTCACGACGAGGCTGACTGCCCGATTATTCGTAGCGGCTAG[C/G,T]
GAGGTATAGGAGAAGATGCAGAAAGAAATCGAGCATTAGAGCTAGCACTACTTGAGAAACCATCTTTGTCTGGTCGGCCAAAAACCACAATAATCCCGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 45.60% | 0.28% | 0.55% | A: 0.02% |
| All Indica | 2759 | 27.30% | 71.50% | 0.40% | 0.83% | NA |
| All Japonica | 1512 | 98.90% | 0.80% | 0.13% | 0.13% | NA |
| Aus | 269 | 48.70% | 51.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 6.40% | 92.30% | 1.01% | 0.34% | NA |
| Indica II | 465 | 53.80% | 45.20% | 0.00% | 1.08% | NA |
| Indica III | 913 | 26.90% | 72.30% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 27.90% | 70.40% | 0.64% | 1.15% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 0.00% | 1.11% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912195782 | G -> DEL | N | N | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> C | LOC_Os09g20330.1 | upstream_gene_variant ; 359.0bp to feature; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> C | LOC_Os09g20320.1 | downstream_gene_variant ; 2307.0bp to feature; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> C | LOC_Os09g20320-LOC_Os09g20330 | intergenic_region ; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> A | LOC_Os09g20330.1 | upstream_gene_variant ; 359.0bp to feature; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> A | LOC_Os09g20320.1 | downstream_gene_variant ; 2307.0bp to feature; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| vg0912195782 | G -> A | LOC_Os09g20320-LOC_Os09g20330 | intergenic_region ; MODIFIER | silent_mutation | Average:64.009; most accessible tissue: Zhenshan97 flower, score: 84.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912195782 | NA | 3.57E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | 2.74E-06 | 2.61E-11 | mr1425 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | 4.36E-06 | 2.04E-10 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 7.40E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 9.45E-06 | mr1642 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 1.24E-11 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 4.98E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 4.91E-14 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 1.06E-08 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 2.20E-07 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 3.48E-10 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912195782 | NA | 3.48E-10 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |