\
| Variant ID: vg0912184179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12184179 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.32, others allele: 0.00, population size: 218. )
TATCAAGAGACCCCCAAGATCAATTTTTCCTTCCCCTTTCGCAACAAGCGTTTGATAAATATAAGGACATGCAAGAAAATCTCCATTCCTTTACCCTTCA[G/A]
GAGGTTGATGATTCATGGACATTCGTTTGGGGATCAGGGAAATTCACTTCGCGACTCTGTTACAAGCTCAGTTTTCTGGCTCTCACTCCCCCACCTACTA
TAGTAGGTGGGGGAGTGAGAGCCAGAAAACTGAGCTTGTAACAGAGTCGCGAAGTGAATTTCCCTGATCCCCAAACGAATGTCCATGAATCATCAACCTC[C/T]
TGAAGGGTAAAGGAATGGAGATTTTCTTGCATGTCCTTATATTTATCAAACGCTTGTTGCGAAAGGGGAAGGAAAAATTGATCTTGGGGGTCTCTTGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.40% | 46.80% | 0.32% | 0.44% | NA |
| All Indica | 2759 | 26.80% | 72.20% | 0.40% | 0.62% | NA |
| All Japonica | 1512 | 98.40% | 1.20% | 0.26% | 0.13% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 7.60% | 91.60% | 0.34% | 0.50% | NA |
| Indica II | 465 | 54.00% | 45.20% | 0.43% | 0.43% | NA |
| Indica III | 913 | 24.60% | 74.70% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 27.90% | 70.50% | 0.89% | 0.76% | NA |
| Temperate Japonica | 767 | 98.30% | 1.30% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912184179 | G -> DEL | N | N | silent_mutation | Average:34.698; most accessible tissue: Callus, score: 54.158 | N | N | N | N |
| vg0912184179 | G -> A | LOC_Os09g20300.1 | downstream_gene_variant ; 3814.0bp to feature; MODIFIER | silent_mutation | Average:34.698; most accessible tissue: Callus, score: 54.158 | N | N | N | N |
| vg0912184179 | G -> A | LOC_Os09g20300-LOC_Os09g20310 | intergenic_region ; MODIFIER | silent_mutation | Average:34.698; most accessible tissue: Callus, score: 54.158 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912184179 | NA | 9.25E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | 3.60E-06 | 1.90E-11 | mr1425 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | 8.19E-06 | 4.62E-10 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 4.70E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 4.01E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 3.72E-13 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 7.92E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 5.29E-10 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 8.91E-14 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 9.71E-09 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 8.57E-08 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 1.25E-10 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 7.06E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 1.25E-10 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912184179 | NA | 7.06E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |