Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912077331:

Variant ID: vg0912077331 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12077331
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TACCAAATTCCTCTGGAAATCAAAATATTTGGATGATTACTCTTTAAAGATTAGCATCCTAAGAAAAGACAATATGTTCAAAAGAGGATATGGAAGAATG[G/A]
GAAAAAGAAATACCAATTTTGTACCGATGATGACACAAATGTCAAGATTCATGTCTGGTTGAGAGTGGTAGCATCTTGAGGCTATCTGCATCTTAGGGCA

Reverse complement sequence

TGCCCTAAGATGCAGATAGCCTCAAGATGCTACCACTCTCAACCAGACATGAATCTTGACATTTGTGTCATCATCGGTACAAAATTGGTATTTCTTTTTC[C/T]
CATTCTTCCATATCCTCTTTTGAACATATTGTCTTTTCTTAGGATGCTAATCTTTAAAGAGTAATCATCCAAATATTTTGATTTCCAGAGGAATTTGGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	17.50%	0.72%	0.00%	NA
All Indica	2759	70.10%	28.80%	1.12%	0.00%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	81.50%	16.50%	2.02%	0.00%	NA
Indica II	465	88.60%	11.20%	0.22%	0.00%	NA
Indica III	913	52.20%	47.50%	0.22%	0.00%	NA
Indica Intermediate	786	71.10%	26.80%	2.04%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912077331	G -> A	LOC_Os09g20160.1	upstream_gene_variant ; 1837.0bp to feature; MODIFIER	silent_mutation	Average:35.036; most accessible tissue: Callus, score: 64.505	N	N	N	N
vg0912077331	G -> A	LOC_Os09g20170.1	downstream_gene_variant ; 3120.0bp to feature; MODIFIER	silent_mutation	Average:35.036; most accessible tissue: Callus, score: 64.505	N	N	N	N
vg0912077331	G -> A	LOC_Os09g20160-LOC_Os09g20170	intergenic_region ; MODIFIER	silent_mutation	Average:35.036; most accessible tissue: Callus, score: 64.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912077331	NA	7.95E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	5.54E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	1.68E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	2.77E-08	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	1.14E-11	mr1180	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	9.38E-11	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	8.11E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	2.87E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	2.79E-11	mr1503	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	1.36E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	8.63E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	1.34E-11	mr1180_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331	NA	3.91E-10	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251