\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912077331:

Variant ID: vg0912077331 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12077331
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TACCAAATTCCTCTGGAAATCAAAATATTTGGATGATTACTCTTTAAAGATTAGCATCCTAAGAAAAGACAATATGTTCAAAAGAGGATATGGAAGAATG[G/A]
GAAAAAGAAATACCAATTTTGTACCGATGATGACACAAATGTCAAGATTCATGTCTGGTTGAGAGTGGTAGCATCTTGAGGCTATCTGCATCTTAGGGCA

Reverse complement sequence

TGCCCTAAGATGCAGATAGCCTCAAGATGCTACCACTCTCAACCAGACATGAATCTTGACATTTGTGTCATCATCGGTACAAAATTGGTATTTCTTTTTC[C/T]
CATTCTTCCATATCCTCTTTTGAACATATTGTCTTTTCTTAGGATGCTAATCTTTAAAGAGTAATCATCCAAATATTTTGATTTCCAGAGGAATTTGGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 17.50% 0.72% 0.00% NA
All Indica  2759 70.10% 28.80% 1.12% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 81.50% 16.50% 2.02% 0.00% NA
Indica II  465 88.60% 11.20% 0.22% 0.00% NA
Indica III  913 52.20% 47.50% 0.22% 0.00% NA
Indica Intermediate  786 71.10% 26.80% 2.04% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912077331 G -> A LOC_Os09g20160.1 upstream_gene_variant ; 1837.0bp to feature; MODIFIER silent_mutation Average:35.036; most accessible tissue: Callus, score: 64.505 N N N N
vg0912077331 G -> A LOC_Os09g20170.1 downstream_gene_variant ; 3120.0bp to feature; MODIFIER silent_mutation Average:35.036; most accessible tissue: Callus, score: 64.505 N N N N
vg0912077331 G -> A LOC_Os09g20160-LOC_Os09g20170 intergenic_region ; MODIFIER silent_mutation Average:35.036; most accessible tissue: Callus, score: 64.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912077331 NA 7.95E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 5.54E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 1.68E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 2.77E-08 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 1.14E-11 mr1180 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 9.38E-11 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 8.11E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 2.87E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 2.79E-11 mr1503 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 1.36E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 8.63E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 1.34E-11 mr1180_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912077331 NA 3.91E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251