Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911893007:

Variant ID: vg0911893007 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11893007
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGTCGTGTAATGTCAGACTTCGGCATGTCATGTCTTTAGGTCTCGTGATGTAACATCAGACTAAGGCGCCTAACATCTTTAGGTATGCTGATGTATGT[T/C]
GGACTTCGACACGTAATGTTATGTTATATTATCGAACTCTACATATATGTTAAATTGCACGTCATCGTTATGTACCATTAGTAACGTTTGCTATATTTAA

Reverse complement sequence

TTAAATATAGCAAACGTTACTAATGGTACATAACGATGACGTGCAATTTAACATATATGTAGAGTTCGATAATATAACATAACATTACGTGTCGAAGTCC[A/G]
ACATACATCAGCATACCTAAAGATGTTAGGCGCCTTAGTCTGATGTTACATCACGAGACCTAAAGACATGACATGCCGAAGTCTGACATTACACGACGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	9.90%	20.72%	8.80%	NA
All Indica	2759	37.30%	16.30%	32.08%	14.32%	NA
All Japonica	1512	98.50%	0.30%	0.53%	0.73%	NA
Aus	269	68.40%	2.20%	26.77%	2.60%	NA
Indica I	595	16.80%	9.40%	37.82%	35.97%	NA
Indica II	465	63.70%	4.10%	21.94%	10.32%	NA
Indica III	913	36.50%	30.70%	28.37%	4.49%	NA
Indica Intermediate	786	38.00%	12.20%	38.04%	11.70%	NA
Temperate Japonica	767	99.20%	0.10%	0.52%	0.13%	NA
Tropical Japonica	504	98.80%	0.00%	0.60%	0.60%	NA
Japonica Intermediate	241	95.40%	1.20%	0.41%	2.90%	NA
VI/Aromatic	96	89.60%	4.20%	6.25%	0.00%	NA
Intermediate	90	82.20%	5.60%	8.89%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911893007	T -> DEL	N	N	silent_mutation	Average:16.549; most accessible tissue: Callus, score: 39.711	N	N	N	N
vg0911893007	T -> C	LOC_Os09g19880.1	upstream_gene_variant ; 3007.0bp to feature; MODIFIER	silent_mutation	Average:16.549; most accessible tissue: Callus, score: 39.711	N	N	N	N
vg0911893007	T -> C	LOC_Os09g19860.1	downstream_gene_variant ; 3903.0bp to feature; MODIFIER	silent_mutation	Average:16.549; most accessible tissue: Callus, score: 39.711	N	N	N	N
vg0911893007	T -> C	LOC_Os09g19870.1	intron_variant ; MODIFIER	silent_mutation	Average:16.549; most accessible tissue: Callus, score: 39.711	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911893007	NA	2.66E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	8.97E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.22E-14	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	6.01E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	3.34E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.29E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	4.74E-08	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	6.06E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.08E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.43E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.46E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	5.37E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	4.31E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	7.61E-09	mr1749	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.91E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.84E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	2.65E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	3.85E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.02E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	1.02E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911893007	NA	4.52E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251