\
| Variant ID: vg0911580904 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11580904 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCAAACATGTAAATCATTCACAATTAATTTCTAGTAATTCGTATAGTTTAACAACATATGAACTATTCCCTCCGTCCCAAAATAACTCAACCTAGGATG[G/A]
GATGTGACCCATCGTAGGCCAACGAATCTGGACATAGGGAATATGTCACATCTAATACTAGGTTGAGTTATTTTGGCATAGAGGGAGTATATATTAAGAA
TTCTTAATATATACTCCCTCTATGCCAAAATAACTCAACCTAGTATTAGATGTGACATATTCCCTATGTCCAGATTCGTTGGCCTACGATGGGTCACATC[C/T]
CATCCTAGGTTGAGTTATTTTGGGACGGAGGGAATAGTTCATATGTTGTTAAACTATACGAATTACTAGAAATTAATTGTGAATGATTTACATGTTTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 3.50% | 2.75% | 8.38% | NA |
| All Indica | 2759 | 85.20% | 4.30% | 3.37% | 7.10% | NA |
| All Japonica | 1512 | 88.20% | 2.90% | 0.99% | 7.87% | NA |
| Aus | 269 | 67.30% | 1.10% | 5.95% | 25.65% | NA |
| Indica I | 595 | 98.70% | 0.30% | 0.34% | 0.67% | NA |
| Indica II | 465 | 73.50% | 8.60% | 6.24% | 11.61% | NA |
| Indica III | 913 | 83.80% | 4.50% | 3.50% | 8.21% | NA |
| Indica Intermediate | 786 | 83.70% | 4.50% | 3.82% | 8.02% | NA |
| Temperate Japonica | 767 | 83.20% | 2.30% | 1.43% | 13.04% | NA |
| Tropical Japonica | 504 | 92.90% | 3.00% | 0.79% | 3.37% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 86.70% | 0.00% | 2.22% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911580904 | G -> DEL | N | N | silent_mutation | Average:29.882; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0911580904 | G -> A | LOC_Os09g19350.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.882; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911580904 | NA | 7.95E-07 | mr1137_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | 3.67E-06 | 3.67E-06 | mr1262_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | 1.57E-06 | 4.65E-07 | mr1388_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 5.80E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 8.42E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 1.24E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 1.06E-07 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | 7.83E-06 | 2.07E-06 | mr1649_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 3.82E-07 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 7.83E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911580904 | NA | 8.01E-07 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |