\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911559557:

Variant ID: vg0911559557 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11559557
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATAACCACAGGTTATATTTATTTTCTCATATAACCCAGTGCATTCAATCCAATTAACACAATACCACAGGTTTAAGTGTGGGAAAGTGCCACAATGG[C/T]
AAGTGACATGGCAGACCTGCTCCATATCAGCTGGCCCCACCTGCCAGATCAATGCGTGGGCTATTTAGGGCGGGATCATGCGGGAGAACGGAAGCACCCA

Reverse complement sequence

TGGGTGCTTCCGTTCTCCCGCATGATCCCGCCCTAAATAGCCCACGCATTGATCTGGCAGGTGGGGCCAGCTGATATGGAGCAGGTCTGCCATGTCACTT[G/A]
CCATTGTGGCACTTTCCCACACTTAAACCTGTGGTATTGTGTTAATTGGATTGAATGCACTGGGTTATATGAGAAAATAAATATAACCTGTGGTTATGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 8.70% 3.47% 14.28% NA
All Indica  2759 64.80% 14.30% 5.33% 15.62% NA
All Japonica  1512 89.00% 0.20% 0.33% 10.52% NA
Aus  269 71.00% 3.00% 2.97% 23.05% NA
Indica I  595 84.90% 6.60% 3.70% 4.87% NA
Indica II  465 55.10% 5.80% 4.30% 34.84% NA
Indica III  913 57.70% 25.00% 7.01% 10.30% NA
Indica Intermediate  786 63.50% 12.70% 5.22% 18.58% NA
Temperate Japonica  767 82.80% 0.30% 0.65% 16.30% NA
Tropical Japonica  504 94.40% 0.20% 0.00% 5.36% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 83.30% 2.10% 1.04% 13.54% NA
Intermediate  90 80.00% 5.60% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911559557 C -> DEL LOC_Os09g19320.1 N frameshift_variant Average:57.321; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg0911559557 C -> T LOC_Os09g19320.1 missense_variant ; p.Ala2Val; MODERATE nonsynonymous_codon ; A2V Average:57.321; most accessible tissue: Zhenshan97 panicle, score: 88.625 unknown unknown TOLERATED 0.06

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0911559557 C T -0.01 0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911559557 8.46E-06 2.56E-08 mr1210 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 1.17E-08 mr1305 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 3.82E-10 mr1586 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 7.17E-09 mr1092_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 7.67E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 4.35E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 5.64E-08 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 2.13E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 1.02E-06 mr1331_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 4.01E-06 mr1331_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 2.31E-06 mr1400_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 8.72E-06 mr1400_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 3.57E-06 mr1460_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 9.64E-07 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 1.80E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911559557 NA 9.99E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251