| Variant ID: vg0911441487 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 11441487 |
| Reference Allele: C | Alternative Allele: T,CATCCATATG |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTGTCTATCAATAACACTCAAAAACATTTCAATTTTAAAGCGATGAAGATTCTGCACTTTACCAAAGAACCTTGGTGATCTTACAACCGGCTTGTATC[C/T,CATCCATATG]
AGTGGCGGATCTTCTCTTGTGGCAAGGGATGGCGCCGGCCATACCTATGCCATGCCCAAAGTAGGTAGGGTATTTAAGCATATGGCCATGTCAGCCTTGA
TCAAGGCTGACATGGCCATATGCTTAAATACCCTACCTACTTTGGGCATGGCATAGGTATGGCCGGCGCCATCCCTTGCCACAAGAGAAGATCCGCCACT[G/A,CATATGGATG]
GATACAAGCCGGTTGTAAGATCACCAAGGTTCTTTGGTAAAGTGCAGAATCTTCATCGCTTTAAAATTGAAATGTTTTTGAGTGTTATTGATAGACAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 11.70% | 14.71% | 36.39% | CATCCATATG: 0.74% |
| All Indica | 2759 | 19.90% | 16.90% | 21.96% | 40.16% | CATCCATATG: 1.12% |
| All Japonica | 1512 | 73.10% | 0.30% | 0.66% | 25.93% | CATCCATATG: 0.07% |
| Aus | 269 | 5.20% | 27.10% | 15.99% | 50.56% | CATCCATATG: 1.12% |
| Indica I | 595 | 19.20% | 5.50% | 17.82% | 57.14% | CATCCATATG: 0.34% |
| Indica II | 465 | 14.20% | 22.20% | 28.17% | 34.41% | CATCCATATG: 1.08% |
| Indica III | 913 | 21.00% | 20.40% | 21.03% | 35.93% | CATCCATATG: 1.64% |
| Indica Intermediate | 786 | 22.50% | 18.20% | 22.52% | 35.62% | CATCCATATG: 1.15% |
| Temperate Japonica | 767 | 68.80% | 0.00% | 1.17% | 29.99% | NA |
| Tropical Japonica | 504 | 81.00% | 0.40% | 0.00% | 18.45% | CATCCATATG: 0.20% |
| Japonica Intermediate | 241 | 70.10% | 0.80% | 0.41% | 28.63% | NA |
| VI/Aromatic | 96 | 9.40% | 6.20% | 20.83% | 63.54% | NA |
| Intermediate | 90 | 48.90% | 7.80% | 17.78% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911441487 | C -> CATCCATATG | LOC_Os09g19150.1 | downstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> CATCCATATG | LOC_Os09g19150.2 | downstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> CATCCATATG | LOC_Os09g19140-LOC_Os09g19150 | intergenic_region ; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> DEL | N | N | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> T | LOC_Os09g19150.1 | downstream_gene_variant ; 399.0bp to feature; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> T | LOC_Os09g19150.2 | downstream_gene_variant ; 399.0bp to feature; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| vg0911441487 | C -> T | LOC_Os09g19140-LOC_Os09g19150 | intergenic_region ; MODIFIER | silent_mutation | Average:12.038; most accessible tissue: Callus, score: 63.928 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911441487 | 8.11E-06 | 4.87E-07 | mr1173 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911441487 | 8.78E-06 | 2.34E-07 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911441487 | 7.09E-06 | 7.09E-06 | mr1381 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911441487 | NA | 3.28E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911441487 | NA | 4.74E-07 | mr1923 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |