Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0911437019:

Variant ID: vg0911437019 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11437019
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCTGGCAGGTTAAATACTATAATGGTTATGAATCGCAACGTTCAGTGCACTGATCTTTTACTCCCCCGTCCTAAGATATAAAAACTTTTAACCTATAG[G/T]
ATTTGTCCCAAAATATAATAATTTCTCCACCAACATTCTTTTCCCAACTAATCACAACCCTCCACTATTCACTTTTCCTACCTACCTCCACTACTCATCC

Reverse complement sequence

GGATGAGTAGTGGAGGTAGGTAGGAAAAGTGAATAGTGGAGGGTTGTGATTAGTTGGGAAAAGAATGTTGGTGGAGAAATTATTATATTTTGGGACAAAT[C/A]
CTATAGGTTAAAAGTTTTTATATCTTAGGACGGGGGAGTAAAAGATCAGTGCACTGAACGTTGCGATTCATAACCATTATAGTATTTAACCTGCCAGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	8.00%	0.87%	38.76%	NA
All Indica	2759	46.70%	9.30%	0.83%	43.20%	NA
All Japonica	1512	73.10%	0.50%	0.53%	25.86%	NA
Aus	269	4.80%	36.80%	2.97%	55.39%	NA
Indica I	595	29.10%	6.70%	0.34%	63.87%	NA
Indica II	465	59.80%	0.90%	1.29%	38.06%	NA
Indica III	913	48.20%	16.10%	1.10%	34.61%	NA
Indica Intermediate	786	50.50%	8.30%	0.64%	40.59%	NA
Temperate Japonica	767	68.80%	0.10%	0.78%	30.25%	NA
Tropical Japonica	504	81.00%	0.60%	0.20%	18.25%	NA
Japonica Intermediate	241	70.10%	1.70%	0.41%	27.80%	NA
VI/Aromatic	96	11.50%	8.30%	2.08%	78.12%	NA
Intermediate	90	66.70%	5.60%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911437019	G -> DEL	N	N	silent_mutation	Average:34.503; most accessible tissue: Callus, score: 70.114	N	N	N	N
vg0911437019	G -> T	LOC_Os09g19140.1	upstream_gene_variant ; 646.0bp to feature; MODIFIER	silent_mutation	Average:34.503; most accessible tissue: Callus, score: 70.114	N	N	N	N
vg0911437019	G -> T	LOC_Os09g19150.1	downstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:34.503; most accessible tissue: Callus, score: 70.114	N	N	N	N
vg0911437019	G -> T	LOC_Os09g19150.2	downstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:34.503; most accessible tissue: Callus, score: 70.114	N	N	N	N
vg0911437019	G -> T	LOC_Os09g19140-LOC_Os09g19150	intergenic_region ; MODIFIER	silent_mutation	Average:34.503; most accessible tissue: Callus, score: 70.114	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911437019	NA	3.08E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019	NA	2.84E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019	7.99E-06	NA	mr1402	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019	NA	1.77E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019	NA	9.27E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019	NA	1.27E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251