\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911437019:

Variant ID: vg0911437019 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11437019
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCTGGCAGGTTAAATACTATAATGGTTATGAATCGCAACGTTCAGTGCACTGATCTTTTACTCCCCCGTCCTAAGATATAAAAACTTTTAACCTATAG[G/T]
ATTTGTCCCAAAATATAATAATTTCTCCACCAACATTCTTTTCCCAACTAATCACAACCCTCCACTATTCACTTTTCCTACCTACCTCCACTACTCATCC

Reverse complement sequence

GGATGAGTAGTGGAGGTAGGTAGGAAAAGTGAATAGTGGAGGGTTGTGATTAGTTGGGAAAAGAATGTTGGTGGAGAAATTATTATATTTTGGGACAAAT[C/A]
CTATAGGTTAAAAGTTTTTATATCTTAGGACGGGGGAGTAAAAGATCAGTGCACTGAACGTTGCGATTCATAACCATTATAGTATTTAACCTGCCAGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 8.00% 0.87% 38.76% NA
All Indica  2759 46.70% 9.30% 0.83% 43.20% NA
All Japonica  1512 73.10% 0.50% 0.53% 25.86% NA
Aus  269 4.80% 36.80% 2.97% 55.39% NA
Indica I  595 29.10% 6.70% 0.34% 63.87% NA
Indica II  465 59.80% 0.90% 1.29% 38.06% NA
Indica III  913 48.20% 16.10% 1.10% 34.61% NA
Indica Intermediate  786 50.50% 8.30% 0.64% 40.59% NA
Temperate Japonica  767 68.80% 0.10% 0.78% 30.25% NA
Tropical Japonica  504 81.00% 0.60% 0.20% 18.25% NA
Japonica Intermediate  241 70.10% 1.70% 0.41% 27.80% NA
VI/Aromatic  96 11.50% 8.30% 2.08% 78.12% NA
Intermediate  90 66.70% 5.60% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911437019 G -> DEL N N silent_mutation Average:34.503; most accessible tissue: Callus, score: 70.114 N N N N
vg0911437019 G -> T LOC_Os09g19140.1 upstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:34.503; most accessible tissue: Callus, score: 70.114 N N N N
vg0911437019 G -> T LOC_Os09g19150.1 downstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:34.503; most accessible tissue: Callus, score: 70.114 N N N N
vg0911437019 G -> T LOC_Os09g19150.2 downstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:34.503; most accessible tissue: Callus, score: 70.114 N N N N
vg0911437019 G -> T LOC_Os09g19140-LOC_Os09g19150 intergenic_region ; MODIFIER silent_mutation Average:34.503; most accessible tissue: Callus, score: 70.114 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911437019 NA 3.08E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019 NA 2.84E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019 7.99E-06 NA mr1402 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019 NA 1.77E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019 NA 9.27E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911437019 NA 1.27E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251