| Variant ID: vg0911437019 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11437019 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATCTGGCAGGTTAAATACTATAATGGTTATGAATCGCAACGTTCAGTGCACTGATCTTTTACTCCCCCGTCCTAAGATATAAAAACTTTTAACCTATAG[G/T]
ATTTGTCCCAAAATATAATAATTTCTCCACCAACATTCTTTTCCCAACTAATCACAACCCTCCACTATTCACTTTTCCTACCTACCTCCACTACTCATCC
GGATGAGTAGTGGAGGTAGGTAGGAAAAGTGAATAGTGGAGGGTTGTGATTAGTTGGGAAAAGAATGTTGGTGGAGAAATTATTATATTTTGGGACAAAT[C/A]
CTATAGGTTAAAAGTTTTTATATCTTAGGACGGGGGAGTAAAAGATCAGTGCACTGAACGTTGCGATTCATAACCATTATAGTATTTAACCTGCCAGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.40% | 8.00% | 0.87% | 38.76% | NA |
| All Indica | 2759 | 46.70% | 9.30% | 0.83% | 43.20% | NA |
| All Japonica | 1512 | 73.10% | 0.50% | 0.53% | 25.86% | NA |
| Aus | 269 | 4.80% | 36.80% | 2.97% | 55.39% | NA |
| Indica I | 595 | 29.10% | 6.70% | 0.34% | 63.87% | NA |
| Indica II | 465 | 59.80% | 0.90% | 1.29% | 38.06% | NA |
| Indica III | 913 | 48.20% | 16.10% | 1.10% | 34.61% | NA |
| Indica Intermediate | 786 | 50.50% | 8.30% | 0.64% | 40.59% | NA |
| Temperate Japonica | 767 | 68.80% | 0.10% | 0.78% | 30.25% | NA |
| Tropical Japonica | 504 | 81.00% | 0.60% | 0.20% | 18.25% | NA |
| Japonica Intermediate | 241 | 70.10% | 1.70% | 0.41% | 27.80% | NA |
| VI/Aromatic | 96 | 11.50% | 8.30% | 2.08% | 78.12% | NA |
| Intermediate | 90 | 66.70% | 5.60% | 0.00% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911437019 | G -> DEL | N | N | silent_mutation | Average:34.503; most accessible tissue: Callus, score: 70.114 | N | N | N | N |
| vg0911437019 | G -> T | LOC_Os09g19140.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:34.503; most accessible tissue: Callus, score: 70.114 | N | N | N | N |
| vg0911437019 | G -> T | LOC_Os09g19150.1 | downstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:34.503; most accessible tissue: Callus, score: 70.114 | N | N | N | N |
| vg0911437019 | G -> T | LOC_Os09g19150.2 | downstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:34.503; most accessible tissue: Callus, score: 70.114 | N | N | N | N |
| vg0911437019 | G -> T | LOC_Os09g19140-LOC_Os09g19150 | intergenic_region ; MODIFIER | silent_mutation | Average:34.503; most accessible tissue: Callus, score: 70.114 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911437019 | NA | 3.08E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911437019 | NA | 2.84E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911437019 | 7.99E-06 | NA | mr1402 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911437019 | NA | 1.77E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911437019 | NA | 9.27E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911437019 | NA | 1.27E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |