\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911386355:

Variant ID: vg0911386355 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11386355
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATGAACAGCCACGAAAAATCAGGAGATCAAATAGTAATTAAAAATTAATCTCATAAAAGTTTGACTAGAACGGCAAACCCGAGTAGAAGATTGAAAC[C/T]
GTCGAACTCATTGAGATCGATCTCGGCACATCTCTAGAAATTGATTCCATCGTACTTCTCGATGGAAAGCTCGACGCACCCCTACCTGGCGCGCCAACTG

Reverse complement sequence

CAGTTGGCGCGCCAGGTAGGGGTGCGTCGAGCTTTCCATCGAGAAGTACGATGGAATCAATTTCTAGAGATGTGCCGAGATCGATCTCAATGAGTTCGAC[G/A]
GTTTCAATCTTCTACTCGGGTTTGCCGTTCTAGTCAAACTTTTATGAGATTAATTTTTAATTACTATTTGATCTCCTGATTTTTCGTGGCTGTTCATATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.10% 5.20% 1.33% 63.42% NA
All Indica  2759 7.10% 8.70% 0.87% 83.33% NA
All Japonica  1512 74.10% 0.10% 0.99% 24.74% NA
Aus  269 10.80% 0.00% 1.49% 87.73% NA
Indica I  595 5.50% 10.30% 1.01% 83.19% NA
Indica II  465 8.20% 1.30% 1.08% 89.46% NA
Indica III  913 8.00% 11.30% 0.55% 80.18% NA
Indica Intermediate  786 6.50% 9.00% 1.02% 83.46% NA
Temperate Japonica  767 68.10% 0.10% 1.04% 30.77% NA
Tropical Japonica  504 85.50% 0.00% 0.60% 13.89% NA
Japonica Intermediate  241 69.70% 0.40% 1.66% 28.22% NA
VI/Aromatic  96 32.30% 1.00% 18.75% 47.92% NA
Intermediate  90 50.00% 1.10% 2.22% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911386355 C -> DEL N N silent_mutation Average:8.95; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386355 C -> T LOC_Os09g18594.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:8.95; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386355 C -> T LOC_Os09g18594.2 upstream_gene_variant ; 4625.0bp to feature; MODIFIER silent_mutation Average:8.95; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386355 C -> T LOC_Os09g18580.1 downstream_gene_variant ; 2545.0bp to feature; MODIFIER silent_mutation Average:8.95; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386355 C -> T LOC_Os09g18580-LOC_Os09g18594 intergenic_region ; MODIFIER silent_mutation Average:8.95; most accessible tissue: Callus, score: 48.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911386355 1.52E-06 NA mr1371 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911386355 5.91E-06 NA mr1371 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251