\
| Variant ID: vg0911386355 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11386355 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATATGAACAGCCACGAAAAATCAGGAGATCAAATAGTAATTAAAAATTAATCTCATAAAAGTTTGACTAGAACGGCAAACCCGAGTAGAAGATTGAAAC[C/T]
GTCGAACTCATTGAGATCGATCTCGGCACATCTCTAGAAATTGATTCCATCGTACTTCTCGATGGAAAGCTCGACGCACCCCTACCTGGCGCGCCAACTG
CAGTTGGCGCGCCAGGTAGGGGTGCGTCGAGCTTTCCATCGAGAAGTACGATGGAATCAATTTCTAGAGATGTGCCGAGATCGATCTCAATGAGTTCGAC[G/A]
GTTTCAATCTTCTACTCGGGTTTGCCGTTCTAGTCAAACTTTTATGAGATTAATTTTTAATTACTATTTGATCTCCTGATTTTTCGTGGCTGTTCATATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.10% | 5.20% | 1.33% | 63.42% | NA |
| All Indica | 2759 | 7.10% | 8.70% | 0.87% | 83.33% | NA |
| All Japonica | 1512 | 74.10% | 0.10% | 0.99% | 24.74% | NA |
| Aus | 269 | 10.80% | 0.00% | 1.49% | 87.73% | NA |
| Indica I | 595 | 5.50% | 10.30% | 1.01% | 83.19% | NA |
| Indica II | 465 | 8.20% | 1.30% | 1.08% | 89.46% | NA |
| Indica III | 913 | 8.00% | 11.30% | 0.55% | 80.18% | NA |
| Indica Intermediate | 786 | 6.50% | 9.00% | 1.02% | 83.46% | NA |
| Temperate Japonica | 767 | 68.10% | 0.10% | 1.04% | 30.77% | NA |
| Tropical Japonica | 504 | 85.50% | 0.00% | 0.60% | 13.89% | NA |
| Japonica Intermediate | 241 | 69.70% | 0.40% | 1.66% | 28.22% | NA |
| VI/Aromatic | 96 | 32.30% | 1.00% | 18.75% | 47.92% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 2.22% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911386355 | C -> DEL | N | N | silent_mutation | Average:8.95; most accessible tissue: Callus, score: 48.523 | N | N | N | N |
| vg0911386355 | C -> T | LOC_Os09g18594.1 | upstream_gene_variant ; 790.0bp to feature; MODIFIER | silent_mutation | Average:8.95; most accessible tissue: Callus, score: 48.523 | N | N | N | N |
| vg0911386355 | C -> T | LOC_Os09g18594.2 | upstream_gene_variant ; 4625.0bp to feature; MODIFIER | silent_mutation | Average:8.95; most accessible tissue: Callus, score: 48.523 | N | N | N | N |
| vg0911386355 | C -> T | LOC_Os09g18580.1 | downstream_gene_variant ; 2545.0bp to feature; MODIFIER | silent_mutation | Average:8.95; most accessible tissue: Callus, score: 48.523 | N | N | N | N |
| vg0911386355 | C -> T | LOC_Os09g18580-LOC_Os09g18594 | intergenic_region ; MODIFIER | silent_mutation | Average:8.95; most accessible tissue: Callus, score: 48.523 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911386355 | 1.52E-06 | NA | mr1371 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911386355 | 5.91E-06 | NA | mr1371 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |