Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0911386355:

Variant ID: vg0911386355 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11386355
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATGAACAGCCACGAAAAATCAGGAGATCAAATAGTAATTAAAAATTAATCTCATAAAAGTTTGACTAGAACGGCAAACCCGAGTAGAAGATTGAAAC[C/T]
GTCGAACTCATTGAGATCGATCTCGGCACATCTCTAGAAATTGATTCCATCGTACTTCTCGATGGAAAGCTCGACGCACCCCTACCTGGCGCGCCAACTG

Reverse complement sequence

CAGTTGGCGCGCCAGGTAGGGGTGCGTCGAGCTTTCCATCGAGAAGTACGATGGAATCAATTTCTAGAGATGTGCCGAGATCGATCTCAATGAGTTCGAC[G/A]
GTTTCAATCTTCTACTCGGGTTTGCCGTTCTAGTCAAACTTTTATGAGATTAATTTTTAATTACTATTTGATCTCCTGATTTTTCGTGGCTGTTCATATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.10%	5.20%	1.33%	63.42%	NA
All Indica	2759	7.10%	8.70%	0.87%	83.33%	NA
All Japonica	1512	74.10%	0.10%	0.99%	24.74%	NA
Aus	269	10.80%	0.00%	1.49%	87.73%	NA
Indica I	595	5.50%	10.30%	1.01%	83.19%	NA
Indica II	465	8.20%	1.30%	1.08%	89.46%	NA
Indica III	913	8.00%	11.30%	0.55%	80.18%	NA
Indica Intermediate	786	6.50%	9.00%	1.02%	83.46%	NA
Temperate Japonica	767	68.10%	0.10%	1.04%	30.77%	NA
Tropical Japonica	504	85.50%	0.00%	0.60%	13.89%	NA
Japonica Intermediate	241	69.70%	0.40%	1.66%	28.22%	NA
VI/Aromatic	96	32.30%	1.00%	18.75%	47.92%	NA
Intermediate	90	50.00%	1.10%	2.22%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911386355	C -> DEL	N	N	silent_mutation	Average:8.95; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386355	C -> T	LOC_Os09g18594.1	upstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:8.95; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386355	C -> T	LOC_Os09g18594.2	upstream_gene_variant ; 4625.0bp to feature; MODIFIER	silent_mutation	Average:8.95; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386355	C -> T	LOC_Os09g18580.1	downstream_gene_variant ; 2545.0bp to feature; MODIFIER	silent_mutation	Average:8.95; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386355	C -> T	LOC_Os09g18580-LOC_Os09g18594	intergenic_region ; MODIFIER	silent_mutation	Average:8.95; most accessible tissue: Callus, score: 48.523	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911386355	1.52E-06	NA	mr1371	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911386355	5.91E-06	NA	mr1371	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251