\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911039399:

Variant ID: vg0911039399 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11039399
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGATCTACAACATGGTTGCTGAACAATTTATTATTTGACATAGTTTATATGGTCATATATGTGTTAGAAATTATCTGATCTAATTGATAAATGCTTTA[A/C]
AATTTTCAAATGAATTGAAGTAGACACAAACACTATATCAAAATTGTACATCTAAGATCTATAGTTTTGTAATTTTATAGTTGATGACCTTAACGTTTAC

Reverse complement sequence

GTAAACGTTAAGGTCATCAACTATAAAATTACAAAACTATAGATCTTAGATGTACAATTTTGATATAGTGTTTGTGTCTACTTCAATTCATTTGAAAATT[T/G]
TAAAGCATTTATCAATTAGATCAGATAATTTCTAACACATATATGACCATATAAACTATGTCAAATAATAAATTGTTCAGCAACCATGTTGTAGATCTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 12.90% 25.56% 17.48% NA
All Indica  2759 22.10% 7.60% 41.21% 29.14% NA
All Japonica  1512 91.80% 6.20% 1.65% 0.33% NA
Aus  269 9.30% 78.10% 10.04% 2.60% NA
Indica I  595 20.50% 2.90% 50.59% 26.05% NA
Indica II  465 17.60% 9.70% 40.86% 31.83% NA
Indica III  913 27.90% 10.20% 31.22% 30.67% NA
Indica Intermediate  786 19.10% 6.90% 45.93% 28.12% NA
Temperate Japonica  767 96.50% 3.40% 0.00% 0.13% NA
Tropical Japonica  504 92.90% 2.20% 4.56% 0.40% NA
Japonica Intermediate  241 74.70% 23.70% 0.83% 0.83% NA
VI/Aromatic  96 9.40% 82.30% 8.33% 0.00% NA
Intermediate  90 55.60% 21.10% 12.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911039399 A -> DEL N N silent_mutation Average:8.401; most accessible tissue: Callus, score: 37.653 N N N N
vg0911039399 A -> C LOC_Os09g18020.1 intron_variant ; MODIFIER silent_mutation Average:8.401; most accessible tissue: Callus, score: 37.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911039399 2.43E-06 3.66E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 2.30E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 5.15E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 8.93E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 4.38E-06 6.44E-13 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 3.78E-08 1.47E-28 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 4.93E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 1.52E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911039399 NA 4.56E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251