\
| Variant ID: vg0911039399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11039399 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAGATCTACAACATGGTTGCTGAACAATTTATTATTTGACATAGTTTATATGGTCATATATGTGTTAGAAATTATCTGATCTAATTGATAAATGCTTTA[A/C]
AATTTTCAAATGAATTGAAGTAGACACAAACACTATATCAAAATTGTACATCTAAGATCTATAGTTTTGTAATTTTATAGTTGATGACCTTAACGTTTAC
GTAAACGTTAAGGTCATCAACTATAAAATTACAAAACTATAGATCTTAGATGTACAATTTTGATATAGTGTTTGTGTCTACTTCAATTCATTTGAAAATT[T/G]
TAAAGCATTTATCAATTAGATCAGATAATTTCTAACACATATATGACCATATAAACTATGTCAAATAATAAATTGTTCAGCAACCATGTTGTAGATCTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 12.90% | 25.56% | 17.48% | NA |
| All Indica | 2759 | 22.10% | 7.60% | 41.21% | 29.14% | NA |
| All Japonica | 1512 | 91.80% | 6.20% | 1.65% | 0.33% | NA |
| Aus | 269 | 9.30% | 78.10% | 10.04% | 2.60% | NA |
| Indica I | 595 | 20.50% | 2.90% | 50.59% | 26.05% | NA |
| Indica II | 465 | 17.60% | 9.70% | 40.86% | 31.83% | NA |
| Indica III | 913 | 27.90% | 10.20% | 31.22% | 30.67% | NA |
| Indica Intermediate | 786 | 19.10% | 6.90% | 45.93% | 28.12% | NA |
| Temperate Japonica | 767 | 96.50% | 3.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 92.90% | 2.20% | 4.56% | 0.40% | NA |
| Japonica Intermediate | 241 | 74.70% | 23.70% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 9.40% | 82.30% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 21.10% | 12.22% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911039399 | A -> DEL | N | N | silent_mutation | Average:8.401; most accessible tissue: Callus, score: 37.653 | N | N | N | N |
| vg0911039399 | A -> C | LOC_Os09g18020.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.401; most accessible tissue: Callus, score: 37.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911039399 | 2.43E-06 | 3.66E-23 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 2.30E-13 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 5.15E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 8.93E-13 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | 4.38E-06 | 6.44E-13 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | 3.78E-08 | 1.47E-28 | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 4.93E-07 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 1.52E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911039399 | NA | 4.56E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |