\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910734141:

Variant ID: vg0910734141 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10734141
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


GCGATGGCGCCGCATAGTCGCCAACGACAACTTTCCGTTTCATATGGATCGCCGGCTCCCGAATCCGGTTGCCGGCCACTACCATTATTCTCGCCGCCGG[G/C]
CCGACGGCCGCGGCCGCAGCAGCCGGCTGATCACCTTCGTCCCCTCCTCGTCCGCTGTCGCGCTCGGCGTCGACGCGCGCCGCCACTTCTCCCTCGACTT

Reverse complement sequence

AAGTCGAGGGAGAAGTGGCGGCGCGCGTCGACGCCGAGCGCGACAGCGGACGAGGAGGGGACGAAGGTGATCAGCCGGCTGCTGCGGCCGCGGCCGTCGG[C/G]
CCGGCGGCGAGAATAATGGTAGTGGCCGGCAACCGGATTCGGGAGCCGGCGATCCATATGAAACGGAAAGTTGTCGTTGGCGACTATGCGGCGCCATCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 16.80% 0.44% 7.70% NA
All Indica  2759 80.20% 10.50% 0.58% 8.66% NA
All Japonica  1512 73.40% 26.30% 0.20% 0.13% NA
Aus  269 26.40% 34.20% 0.00% 39.41% NA
Indica I  595 93.30% 5.50% 0.00% 1.18% NA
Indica II  465 78.70% 9.70% 0.43% 11.18% NA
Indica III  913 69.90% 16.80% 1.10% 12.27% NA
Indica Intermediate  786 83.20% 7.60% 0.51% 8.65% NA
Temperate Japonica  767 54.50% 45.40% 0.13% 0.00% NA
Tropical Japonica  504 94.60% 5.00% 0.20% 0.20% NA
Japonica Intermediate  241 89.20% 10.00% 0.41% 0.41% NA
VI/Aromatic  96 80.20% 6.20% 1.04% 12.50% NA
Intermediate  90 82.20% 11.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910734141 G -> DEL LOC_Os09g17540.1 N frameshift_variant Average:83.527; most accessible tissue: Zhenshan97 root, score: 94.511 N N N N
vg0910734141 G -> C LOC_Os09g17540.1 missense_variant ; p.Ala79Pro; MODERATE nonsynonymous_codon ; A79P Average:83.527; most accessible tissue: Zhenshan97 root, score: 94.511 unknown unknown TOLERATED 0.14

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910734141 G C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910734141 NA 7.45E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.50E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.09E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 8.19E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 3.99E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.05E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 8.59E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.77E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 2.96E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 4.33E-06 4.33E-06 mr1566 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 9.90E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 5.94E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.68E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 8.39E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 4.39E-06 4.38E-06 mr1994 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 3.22E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 2.38E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 9.88E-06 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 4.77E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734141 NA 1.61E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251