Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0910714998:

Variant ID: vg0910714998 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10714998
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGCCGCTGGCAAGCTTGAGATCGAGCTCAGCCATGGCTTGATCTGCTTCAGCTCGAACCAGGGACCTCCTCACAAGAATTTAGGTTAATGTAGGGTC[T/C]
TTTCTGCAAAAGCTCAAGACACACAGAACAGTCATAGGACTGCGGTTTGATTTCCTGAAACCCTAGGGGCTTTTTTGCATATTGGCCTGAGACTGACAGG

Reverse complement sequence

CCTGTCAGTCTCAGGCCAATATGCAAAAAAGCCCCTAGGGTTTCAGGAAATCAAACCGCAGTCCTATGACTGTTCTGTGTGTCTTGAGCTTTTGCAGAAA[A/G]
GACCCTACATTAACCTAAATTCTTGTGAGGAGGTCCCTGGTTCGAGCTGAAGCAGATCAAGCCATGGCTGAGCTCGATCTCAAGCTTGCCAGCGGCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	13.60%	3.47%	14.16%	NA
All Indica	2759	91.40%	7.60%	0.36%	0.65%	NA
All Japonica	1512	22.00%	27.30%	9.26%	41.47%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	89.90%	6.60%	0.84%	2.69%	NA
Indica II	465	94.80%	4.50%	0.22%	0.43%	NA
Indica III	913	86.70%	13.00%	0.22%	0.00%	NA
Indica Intermediate	786	95.90%	3.80%	0.25%	0.00%	NA
Temperate Japonica	767	11.50%	46.80%	5.08%	36.64%	NA
Tropical Japonica	504	38.10%	5.80%	13.49%	42.66%	NA
Japonica Intermediate	241	21.60%	10.40%	13.69%	54.36%	NA
VI/Aromatic	96	77.10%	5.20%	5.21%	12.50%	NA
Intermediate	90	63.30%	16.70%	8.89%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910714998	T -> DEL	N	N	silent_mutation	Average:19.188; most accessible tissue: Callus, score: 64.865	N	N	N	N
vg0910714998	T -> C	LOC_Os09g17510.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:19.188; most accessible tissue: Callus, score: 64.865	N	N	N	N
vg0910714998	T -> C	LOC_Os09g17520.1	upstream_gene_variant ; 3521.0bp to feature; MODIFIER	silent_mutation	Average:19.188; most accessible tissue: Callus, score: 64.865	N	N	N	N
vg0910714998	T -> C	LOC_Os09g17510-LOC_Os09g17520	intergenic_region ; MODIFIER	silent_mutation	Average:19.188; most accessible tissue: Callus, score: 64.865	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910714998	NA	4.62E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910714998	NA	3.18E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	6.45E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	2.42E-06	NA	mr1570	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	4.84E-08	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	8.75E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	1.25E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	7.05E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	1.05E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	1.20E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910714998	NA	5.75E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251