\
| Variant ID: vg0910500003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10500003 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 90. )
ATCGCGCACATGTCTTGTTGCCCGCCTTCTTCCGGGAAGCCACCGAGCTCGCGCCTCCCTCTCTCTCGCGTTCCATCGCCACCGCGCGTGACGTCGCCCA[C/T]
GTCACCTCGCTCTGAGAACTCTACCGCCCAAATCCCGGCCGTAGCCATCATCGGTCACGCGTCACCCATGTTCCACCGCCGTTCCTGCTCTCCGCGCGTC
GACGCGCGGAGAGCAGGAACGGCGGTGGAACATGGGTGACGCGTGACCGATGATGGCTACGGCCGGGATTTGGGCGGTAGAGTTCTCAGAGCGAGGTGAC[G/A]
TGGGCGACGTCACGCGCGGTGGCGATGGAACGCGAGAGAGAGGGAGGCGCGAGCTCGGTGGCTTCCCGGAAGAAGGCGGGCAACAAGACATGTGCGCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 23.70% | 0.55% | 0.32% | NA |
| All Indica | 2759 | 73.90% | 25.30% | 0.25% | 0.51% | NA |
| All Japonica | 1512 | 91.30% | 7.50% | 1.06% | 0.07% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.70% | 53.30% | 0.34% | 0.67% | NA |
| Indica II | 465 | 77.80% | 21.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 86.90% | 12.50% | 0.22% | 0.44% | NA |
| Indica Intermediate | 786 | 77.90% | 21.20% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 4.80% | 3.17% | 0.20% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 81.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910500003 | C -> DEL | N | N | silent_mutation | Average:61.901; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| vg0910500003 | C -> T | LOC_Os09g17130.1 | upstream_gene_variant ; 4009.0bp to feature; MODIFIER | silent_mutation | Average:61.901; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| vg0910500003 | C -> T | LOC_Os09g17130-LOC_Os09g17140 | intergenic_region ; MODIFIER | silent_mutation | Average:61.901; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910500003 | NA | 1.34E-09 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 3.23E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 4.06E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 1.66E-06 | 1.01E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 6.02E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 2.42E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 7.99E-08 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 1.36E-06 | 8.15E-09 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 2.80E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 3.24E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 4.28E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 4.27E-07 | 2.31E-09 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 1.46E-08 | 4.72E-10 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 5.02E-11 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 1.91E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 3.33E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 5.44E-06 | 1.29E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 5.07E-08 | 5.07E-08 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 1.93E-06 | 5.91E-08 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | 7.76E-08 | 1.32E-09 | mr1936 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 8.49E-06 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 3.60E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 2.61E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 1.01E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 3.48E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 5.16E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 1.69E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 1.74E-08 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 2.95E-07 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 7.63E-07 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 1.22E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 9.46E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910500003 | NA | 5.57E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |