\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910384464:

Variant ID: vg0910384464 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10384464
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, G: 0.43, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTGTCTCCATCTGTTTAACCTAAATCTCGTATATACCCTAGTACCAATGATACCCATACTGTCTAAATACCGTAGTCACGATATCAAATGTCGACA[G/C]
TGGCGCGCCAAGTAGGGGGATTTTGGTGCTTCAAGATTCCGGTTGAGATGAGTTCAAGAGATGGATTCTTCGACAACAAACTACTCGACGACTTCGGCTA

Reverse complement sequence

TAGCCGAAGTCGTCGAGTAGTTTGTTGTCGAAGAATCCATCTCTTGAACTCATCTCAACCGGAATCTTGAAGCACCAAAATCCCCCTACTTGGCGCGCCA[C/G]
TGTCGACATTTGATATCGTGACTACGGTATTTAGACAGTATGGGTATCATTGGTACTAGGGTATATACGAGATTTAGGTTAAACAGATGGAGACAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.10% 16.30% 0.66% 61.93% NA
All Indica  2759 1.70% 3.60% 0.94% 93.73% NA
All Japonica  1512 59.10% 37.00% 0.07% 3.84% NA
Aus  269 6.30% 5.20% 0.00% 88.48% NA
Indica I  595 3.40% 8.60% 0.50% 87.56% NA
Indica II  465 1.90% 2.20% 0.65% 95.27% NA
Indica III  913 0.40% 1.00% 1.31% 97.26% NA
Indica Intermediate  786 1.80% 3.80% 1.02% 93.38% NA
Temperate Japonica  767 38.70% 60.00% 0.00% 1.30% NA
Tropical Japonica  504 87.10% 6.20% 0.20% 6.55% NA
Japonica Intermediate  241 65.10% 28.60% 0.00% 6.22% NA
VI/Aromatic  96 11.50% 67.70% 1.04% 19.79% NA
Intermediate  90 31.10% 36.70% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910384464 G -> DEL N N silent_mutation Average:12.742; most accessible tissue: Callus, score: 53.181 N N N N
vg0910384464 G -> C LOC_Os09g16980.1 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 53.181 N N N N
vg0910384464 G -> C LOC_Os09g16990.1 downstream_gene_variant ; 1452.0bp to feature; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 53.181 N N N N
vg0910384464 G -> C LOC_Os09g16995.1 downstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 53.181 N N N N
vg0910384464 G -> C LOC_Os09g16980-LOC_Os09g16990 intergenic_region ; MODIFIER silent_mutation Average:12.742; most accessible tissue: Callus, score: 53.181 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910384464 NA 5.08E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 7.01E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 3.72E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 3.30E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 9.11E-24 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 3.08E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 4.61E-06 NA mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 8.05E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 1.08E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464 NA 2.00E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251