\
| Variant ID: vg0910384464 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10384464 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, G: 0.43, others allele: 0.00, population size: 76. )
ATTCTTGTCTCCATCTGTTTAACCTAAATCTCGTATATACCCTAGTACCAATGATACCCATACTGTCTAAATACCGTAGTCACGATATCAAATGTCGACA[G/C]
TGGCGCGCCAAGTAGGGGGATTTTGGTGCTTCAAGATTCCGGTTGAGATGAGTTCAAGAGATGGATTCTTCGACAACAAACTACTCGACGACTTCGGCTA
TAGCCGAAGTCGTCGAGTAGTTTGTTGTCGAAGAATCCATCTCTTGAACTCATCTCAACCGGAATCTTGAAGCACCAAAATCCCCCTACTTGGCGCGCCA[C/G]
TGTCGACATTTGATATCGTGACTACGGTATTTAGACAGTATGGGTATCATTGGTACTAGGGTATATACGAGATTTAGGTTAAACAGATGGAGACAAGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.10% | 16.30% | 0.66% | 61.93% | NA |
| All Indica | 2759 | 1.70% | 3.60% | 0.94% | 93.73% | NA |
| All Japonica | 1512 | 59.10% | 37.00% | 0.07% | 3.84% | NA |
| Aus | 269 | 6.30% | 5.20% | 0.00% | 88.48% | NA |
| Indica I | 595 | 3.40% | 8.60% | 0.50% | 87.56% | NA |
| Indica II | 465 | 1.90% | 2.20% | 0.65% | 95.27% | NA |
| Indica III | 913 | 0.40% | 1.00% | 1.31% | 97.26% | NA |
| Indica Intermediate | 786 | 1.80% | 3.80% | 1.02% | 93.38% | NA |
| Temperate Japonica | 767 | 38.70% | 60.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 87.10% | 6.20% | 0.20% | 6.55% | NA |
| Japonica Intermediate | 241 | 65.10% | 28.60% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 11.50% | 67.70% | 1.04% | 19.79% | NA |
| Intermediate | 90 | 31.10% | 36.70% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910384464 | G -> DEL | N | N | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 53.181 | N | N | N | N |
| vg0910384464 | G -> C | LOC_Os09g16980.1 | upstream_gene_variant ; 2614.0bp to feature; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 53.181 | N | N | N | N |
| vg0910384464 | G -> C | LOC_Os09g16990.1 | downstream_gene_variant ; 1452.0bp to feature; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 53.181 | N | N | N | N |
| vg0910384464 | G -> C | LOC_Os09g16995.1 | downstream_gene_variant ; 3652.0bp to feature; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 53.181 | N | N | N | N |
| vg0910384464 | G -> C | LOC_Os09g16980-LOC_Os09g16990 | intergenic_region ; MODIFIER | silent_mutation | Average:12.742; most accessible tissue: Callus, score: 53.181 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910384464 | NA | 5.08E-16 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 7.01E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 3.72E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 3.30E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 9.11E-24 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 3.08E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | 4.61E-06 | NA | mr1723 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 8.05E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 1.08E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910384464 | NA | 2.00E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |