\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910259535:

Variant ID: vg0910259535 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10259535
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGAATCAGCCAATGTGGCCGATGGATGACCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTGCGGGCATCATAGACTAGGCTTCCCGAGT[A/G]
GAAGCGGATTGTTGTGCTGCTGGGCAGCAGGACTTTGGGAGTCCGAGAAAAAGGAAAAAGGCTCTGGGAGACGCTTAATCAAGTGAAATGGCTCTGGGAG

Reverse complement sequence

CTCCCAGAGCCATTTCACTTGATTAAGCGTCTCCCAGAGCCTTTTTCCTTTTTCTCGGACTCCCAAAGTCCTGCTGCCCAGCAGCACAACAATCCGCTTC[T/C]
ACTCGGGAAGCCTAGTCTATGATGCCCGCAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGGTCATCCATCGGCCACATTGGCTGATTCTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 23.90% 23.23% 15.34% NA
All Indica  2759 20.80% 22.10% 32.19% 24.90% NA
All Japonica  1512 66.70% 32.60% 0.46% 0.20% NA
Aus  269 18.60% 3.30% 66.54% 11.52% NA
Indica I  595 10.60% 8.20% 35.46% 45.71% NA
Indica II  465 19.10% 12.50% 44.95% 23.44% NA
Indica III  913 30.60% 36.50% 19.39% 13.58% NA
Indica Intermediate  786 18.30% 21.50% 37.02% 23.16% NA
Temperate Japonica  767 41.90% 57.40% 0.65% 0.13% NA
Tropical Japonica  504 97.60% 1.80% 0.20% 0.40% NA
Japonica Intermediate  241 81.30% 18.30% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 4.20% 5.21% 0.00% NA
Intermediate  90 56.70% 17.80% 21.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910259535 A -> G LOC_Os09g16770.1 upstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N
vg0910259535 A -> G LOC_Os09g16790.1 upstream_gene_variant ; 3827.0bp to feature; MODIFIER silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N
vg0910259535 A -> G LOC_Os09g16760.1 downstream_gene_variant ; 4748.0bp to feature; MODIFIER silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N
vg0910259535 A -> G LOC_Os09g16780.1 downstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N
vg0910259535 A -> G LOC_Os09g16770-LOC_Os09g16780 intergenic_region ; MODIFIER silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N
vg0910259535 A -> DEL N N silent_mutation Average:8.78; most accessible tissue: Callus, score: 46.113 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910259535 NA 5.65E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910259535 NA 1.02E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910259535 NA 4.23E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 8.25E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 2.06E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 1.39E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 6.71E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 3.34E-06 NA mr1817 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 3.38E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 8.53E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 6.88E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 7.41E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 3.33E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 2.17E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 1.20E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 4.76E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535 NA 8.04E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251