Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910259535:

Variant ID: vg0910259535 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10259535
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGAATCAGCCAATGTGGCCGATGGATGACCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTGCGGGCATCATAGACTAGGCTTCCCGAGT[A/G]
GAAGCGGATTGTTGTGCTGCTGGGCAGCAGGACTTTGGGAGTCCGAGAAAAAGGAAAAAGGCTCTGGGAGACGCTTAATCAAGTGAAATGGCTCTGGGAG

Reverse complement sequence

CTCCCAGAGCCATTTCACTTGATTAAGCGTCTCCCAGAGCCTTTTTCCTTTTTCTCGGACTCCCAAAGTCCTGCTGCCCAGCAGCACAACAATCCGCTTC[T/C]
ACTCGGGAAGCCTAGTCTATGATGCCCGCAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGGTCATCCATCGGCCACATTGGCTGATTCTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	23.90%	23.23%	15.34%	NA
All Indica	2759	20.80%	22.10%	32.19%	24.90%	NA
All Japonica	1512	66.70%	32.60%	0.46%	0.20%	NA
Aus	269	18.60%	3.30%	66.54%	11.52%	NA
Indica I	595	10.60%	8.20%	35.46%	45.71%	NA
Indica II	465	19.10%	12.50%	44.95%	23.44%	NA
Indica III	913	30.60%	36.50%	19.39%	13.58%	NA
Indica Intermediate	786	18.30%	21.50%	37.02%	23.16%	NA
Temperate Japonica	767	41.90%	57.40%	0.65%	0.13%	NA
Tropical Japonica	504	97.60%	1.80%	0.20%	0.40%	NA
Japonica Intermediate	241	81.30%	18.30%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	4.20%	5.21%	0.00%	NA
Intermediate	90	56.70%	17.80%	21.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910259535	A -> G	LOC_Os09g16770.1	upstream_gene_variant ; 1963.0bp to feature; MODIFIER	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N
vg0910259535	A -> G	LOC_Os09g16790.1	upstream_gene_variant ; 3827.0bp to feature; MODIFIER	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N
vg0910259535	A -> G	LOC_Os09g16760.1	downstream_gene_variant ; 4748.0bp to feature; MODIFIER	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N
vg0910259535	A -> G	LOC_Os09g16780.1	downstream_gene_variant ; 1027.0bp to feature; MODIFIER	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N
vg0910259535	A -> G	LOC_Os09g16770-LOC_Os09g16780	intergenic_region ; MODIFIER	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N
vg0910259535	A -> DEL	N	N	silent_mutation	Average:8.78; most accessible tissue: Callus, score: 46.113	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910259535	NA	5.65E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910259535	NA	1.02E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910259535	NA	4.23E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	8.25E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	2.06E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	1.39E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	6.71E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	3.34E-06	NA	mr1817	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	3.38E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	8.53E-11	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	6.88E-08	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	7.41E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	3.33E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	2.17E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	1.20E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	4.76E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910259535	NA	8.04E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251