\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910197736:

Variant ID: vg0910197736 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10197736
Reference Allele: AAlternative Allele: C,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAATTCTTGTCTGTCCATCCACTACTTATCTTCAGCTTCATTAGGTCCAAGGTAACTGACAACTTAGTGTGTTTTTCTTTGCATCCGGCGTATAGAG[A/C,G]
CGTCTCGGAATCACTGACCAACCTGCTGAACTTAATGGAATCTCTCTCATTCTGGGCTGGGTCCTCAACGTCACTTAACATGTCTTGCAGCAGATCGTGA

Reverse complement sequence

TCACGATCTGCTGCAAGACATGTTAAGTGACGTTGAGGACCCAGCCCAGAATGAGAGAGATTCCATTAAGTTCAGCAGGTTGGTCAGTGATTCCGAGACG[T/G,C]
CTCTATACGCCGGATGCAAAGAAAAACACACTAAGTTGTCAGTTACCTTGGACCTAATGAAGCTGAAGATAAGTAGTGGATGGACAGACAAGAATTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 35.80% 2.88% 21.52% G: 1.16%
All Indica  2759 61.80% 3.30% 4.17% 28.89% G: 1.85%
All Japonica  1512 1.80% 95.50% 0.33% 2.38% NA
Aus  269 26.80% 8.60% 3.72% 60.22% G: 0.74%
Indica I  595 87.60% 6.20% 0.50% 5.55% G: 0.17%
Indica II  465 45.40% 2.80% 3.44% 47.96% G: 0.43%
Indica III  913 52.80% 1.10% 8.00% 33.84% G: 4.27%
Indica Intermediate  786 62.30% 4.10% 2.93% 29.52% G: 1.15%
Temperate Japonica  767 0.40% 98.30% 0.00% 1.30% NA
Tropical Japonica  504 4.80% 91.90% 0.60% 2.78% NA
Japonica Intermediate  241 0.00% 94.20% 0.83% 4.98% NA
VI/Aromatic  96 6.20% 81.20% 1.04% 9.38% G: 2.08%
Intermediate  90 18.90% 61.10% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910197736 A -> G LOC_Os09g16630.1 missense_variant ; p.Ser85Pro; MODERATE nonsynonymous_codon ; S85P Average:38.121; most accessible tissue: Minghui63 young leaf, score: 55.178 benign -0.412 TOLERATED 1.00
vg0910197736 A -> DEL LOC_Os09g16630.1 N frameshift_variant Average:38.121; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0910197736 A -> C LOC_Os09g16630.1 missense_variant ; p.Ser85Ala; MODERATE nonsynonymous_codon ; S85A Average:38.121; most accessible tissue: Minghui63 young leaf, score: 55.178 benign 0.658 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910197736 NA 1.35E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 2.73E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 3.18E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.52E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.29E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 4.73E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 4.31E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.47E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 2.68E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 5.77E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.37E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.99E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 4.99E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 4.32E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 8.51E-11 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 2.99E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 4.86E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 1.69E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 3.73E-16 mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 7.25E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 3.51E-06 NA mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 3.49E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910197736 NA 6.35E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251