\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910121143:

Variant ID: vg0910121143 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10121143
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTCTCGCGAGCTACCGCGTCAAGCATCGATCGCAGCAGGCGCATGCACCGCGATCCCCCCCCCCCCCCCCCCCTCGCTTTTCAGTTTTCTACCCGGGC[A/G]
TAATCCACCGTACTAGTACGTGCTACGACGCGGTGCCCGCCGCGTACTCGATCACTCGCGCGCGATCGCCCCGCGCGCGGACGACGACGAAGCCGCGACA

Reverse complement sequence

TGTCGCGGCTTCGTCGTCGTCCGCGCGCGGGGCGATCGCGCGCGAGTGATCGAGTACGCGGCGGGCACCGCGTCGTAGCACGTACTAGTACGGTGGATTA[T/C]
GCCCGGGTAGAAAACTGAAAAGCGAGGGGGGGGGGGGGGGGGGGATCGCGGTGCATGCGCCTGCTGCGATCGATGCTTGACGCGGTAGCTCGCGAGACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.10% 0.42% 0.47% NA
All Indica  2759 66.20% 33.20% 0.43% 0.14% NA
All Japonica  1512 62.00% 37.30% 0.13% 0.60% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 88.70% 10.80% 0.17% 0.34% NA
Indica II  465 59.10% 39.60% 1.29% 0.00% NA
Indica III  913 54.30% 45.50% 0.22% 0.00% NA
Indica Intermediate  786 67.00% 32.30% 0.38% 0.25% NA
Temperate Japonica  767 94.30% 5.60% 0.13% 0.00% NA
Tropical Japonica  504 8.90% 90.90% 0.00% 0.20% NA
Japonica Intermediate  241 70.10% 26.10% 0.41% 3.32% NA
VI/Aromatic  96 33.30% 56.20% 4.17% 6.25% NA
Intermediate  90 52.20% 42.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910121143 A -> G LOC_Os09g16500-LOC_Os09g16510 intergenic_region ; MODIFIER silent_mutation Average:98.458; most accessible tissue: Zhenshan97 root, score: 99.898 N N N N
vg0910121143 A -> DEL N N silent_mutation Average:98.458; most accessible tissue: Zhenshan97 root, score: 99.898 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910121143 A G 0.0 -0.03 -0.05 -0.05 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910121143 NA 7.50E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 9.21E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.71E-23 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.62E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.25E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 2.75E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 7.49E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 3.32E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 2.21E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 9.92E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 3.10E-06 3.00E-27 mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.39E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.22E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910121143 NA 1.30E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251