\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910044928:

Variant ID: vg0910044928 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10044928
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGGGTCGGGTAGTTGCCTTCATGAGGACGCAACTGTCGTGAAGCATAAGAAACCACTTTGCCATCTTGCATCAACACACATCCTAGCCCCTGGCGAGA[A/T]
GAATCACAATAGAACTGGAAATCTTTCGTCTAATCAGGCAGAATTAAAACTGGAGCAGACACCAACCGTCGTTTGAGTTCTTCAAAACTCCTATTCCATT

Reverse complement sequence

AATGGAATAGGAGTTTTGAAGAACTCAAACGACGGTTGGTGTCTGCTCCAGTTTTAATTCTGCCTGATTAGACGAAAGATTTCCAGTTCTATTGTGATTC[T/A]
TCTCGCCAGGGGCTAGGATGTGTGTTGATGCAAGATGGCAAAGTGGTTTCTTATGCTTCACGACAGTTGCGTCCTCATGAAGGCAACTACCCGACCCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.60% 12.00% 1.08% 63.35% NA
All Indica  2759 4.00% 2.10% 1.56% 92.39% NA
All Japonica  1512 60.80% 28.80% 0.20% 10.19% NA
Aus  269 13.00% 5.20% 0.37% 81.41% NA
Indica I  595 8.90% 4.50% 3.19% 83.36% NA
Indica II  465 1.90% 0.90% 0.86% 96.34% NA
Indica III  913 0.40% 1.40% 1.10% 97.04% NA
Indica Intermediate  786 5.60% 1.70% 1.27% 91.48% NA
Temperate Japonica  767 93.10% 1.60% 0.00% 5.35% NA
Tropical Japonica  504 7.10% 76.80% 0.20% 15.87% NA
Japonica Intermediate  241 70.50% 14.90% 0.83% 13.69% NA
VI/Aromatic  96 31.20% 32.30% 0.00% 36.46% NA
Intermediate  90 21.10% 33.30% 4.44% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910044928 A -> DEL N N silent_mutation Average:12.791; most accessible tissue: Callus, score: 26.618 N N N N
vg0910044928 A -> T LOC_Os09g16420.1 downstream_gene_variant ; 2194.0bp to feature; MODIFIER silent_mutation Average:12.791; most accessible tissue: Callus, score: 26.618 N N N N
vg0910044928 A -> T LOC_Os09g16430.1 intron_variant ; MODIFIER silent_mutation Average:12.791; most accessible tissue: Callus, score: 26.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910044928 NA 5.56E-07 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.20E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.59E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 6.08E-06 6.08E-06 mr1189 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.29E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.01E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.22E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.55E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 6.11E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 7.72E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.43E-08 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 9.54E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.37E-13 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 6.68E-06 6.68E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.32E-07 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 9.17E-09 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 3.19E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.34E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.74E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.18E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 6.45E-06 NA mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 9.89E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 1.31E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.38E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.20E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 8.62E-11 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 7.51E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.86E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.95E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 2.81E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 4.95E-07 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 6.99E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 6.61E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 5.15E-06 3.25E-06 mr1892_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910044928 NA 3.29E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251