| Variant ID: vg0909928084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9928084 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAATAAATGCATTTTAACTAGTGGCCGACCGGCCGCCAGTGCAAATCGAGTTTGACAAACAGCATGCTAAGACAGCCACTAGCAAAAATAGTATGTTTG[T/C]
TGGCGGCATCTAGGAGAACCGCCAGCGAAAACATTTTTGGAGCAAAAAGAAAATTGAAAATCAGGATCCAGATCTGTGCTCGAAACCACGATGATGACGC
GCGTCATCATCGTGGTTTCGAGCACAGATCTGGATCCTGATTTTCAATTTTCTTTTTGCTCCAAAAATGTTTTCGCTGGCGGTTCTCCTAGATGCCGCCA[A/G]
CAAACATACTATTTTTGCTAGTGGCTGTCTTAGCATGCTGTTTGTCAAACTCGATTTGCACTGGCGGCCGGTCGGCCACTAGTTAAAATGCATTTATTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 20.80% | 3.77% | 7.36% | NA |
| All Indica | 2759 | 88.20% | 3.10% | 3.23% | 5.44% | NA |
| All Japonica | 1512 | 28.80% | 54.70% | 5.09% | 11.38% | NA |
| Aus | 269 | 85.10% | 7.40% | 2.23% | 5.20% | NA |
| Indica I | 595 | 84.40% | 6.90% | 5.38% | 3.36% | NA |
| Indica II | 465 | 93.30% | 0.90% | 2.37% | 3.44% | NA |
| Indica III | 913 | 90.30% | 1.10% | 0.99% | 7.67% | NA |
| Indica Intermediate | 786 | 85.80% | 3.90% | 4.71% | 5.60% | NA |
| Temperate Japonica | 767 | 16.80% | 79.90% | 1.43% | 1.83% | NA |
| Tropical Japonica | 504 | 54.00% | 7.50% | 12.30% | 26.19% | NA |
| Japonica Intermediate | 241 | 14.50% | 73.00% | 1.66% | 10.79% | NA |
| VI/Aromatic | 96 | 63.50% | 31.20% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 61.10% | 24.40% | 6.67% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909928084 | T -> DEL | N | N | silent_mutation | Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0909928084 | T -> C | LOC_Os09g16260.2 | upstream_gene_variant ; 1369.0bp to feature; MODIFIER | silent_mutation | Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0909928084 | T -> C | LOC_Os09g16270.1 | upstream_gene_variant ; 91.0bp to feature; MODIFIER | silent_mutation | Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0909928084 | T -> C | LOC_Os09g16260.1 | upstream_gene_variant ; 1369.0bp to feature; MODIFIER | silent_mutation | Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0909928084 | T -> C | LOC_Os09g16260-LOC_Os09g16270 | intergenic_region ; MODIFIER | silent_mutation | Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909928084 | 1.04E-06 | 1.04E-06 | mr1146 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 6.63E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 1.48E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 8.50E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 1.59E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 4.49E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909928084 | NA | 6.65E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |