Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0909928084:

Variant ID: vg0909928084 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9928084
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAATAAATGCATTTTAACTAGTGGCCGACCGGCCGCCAGTGCAAATCGAGTTTGACAAACAGCATGCTAAGACAGCCACTAGCAAAAATAGTATGTTTG[T/C]
TGGCGGCATCTAGGAGAACCGCCAGCGAAAACATTTTTGGAGCAAAAAGAAAATTGAAAATCAGGATCCAGATCTGTGCTCGAAACCACGATGATGACGC

Reverse complement sequence

GCGTCATCATCGTGGTTTCGAGCACAGATCTGGATCCTGATTTTCAATTTTCTTTTTGCTCCAAAAATGTTTTCGCTGGCGGTTCTCCTAGATGCCGCCA[A/G]
CAAACATACTATTTTTGCTAGTGGCTGTCTTAGCATGCTGTTTGTCAAACTCGATTTGCACTGGCGGCCGGTCGGCCACTAGTTAAAATGCATTTATTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	20.80%	3.77%	7.36%	NA
All Indica	2759	88.20%	3.10%	3.23%	5.44%	NA
All Japonica	1512	28.80%	54.70%	5.09%	11.38%	NA
Aus	269	85.10%	7.40%	2.23%	5.20%	NA
Indica I	595	84.40%	6.90%	5.38%	3.36%	NA
Indica II	465	93.30%	0.90%	2.37%	3.44%	NA
Indica III	913	90.30%	1.10%	0.99%	7.67%	NA
Indica Intermediate	786	85.80%	3.90%	4.71%	5.60%	NA
Temperate Japonica	767	16.80%	79.90%	1.43%	1.83%	NA
Tropical Japonica	504	54.00%	7.50%	12.30%	26.19%	NA
Japonica Intermediate	241	14.50%	73.00%	1.66%	10.79%	NA
VI/Aromatic	96	63.50%	31.20%	0.00%	5.21%	NA
Intermediate	90	61.10%	24.40%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909928084	T -> DEL	N	N	silent_mutation	Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0909928084	T -> C	LOC_Os09g16260.2	upstream_gene_variant ; 1369.0bp to feature; MODIFIER	silent_mutation	Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0909928084	T -> C	LOC_Os09g16270.1	upstream_gene_variant ; 91.0bp to feature; MODIFIER	silent_mutation	Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0909928084	T -> C	LOC_Os09g16260.1	upstream_gene_variant ; 1369.0bp to feature; MODIFIER	silent_mutation	Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0909928084	T -> C	LOC_Os09g16260-LOC_Os09g16270	intergenic_region ; MODIFIER	silent_mutation	Average:41.283; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909928084	1.04E-06	1.04E-06	mr1146	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	6.63E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	1.48E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	8.50E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	1.59E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	4.49E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909928084	NA	6.65E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251